Description :
From Genome Similarity Track
Location :
Scaffold_142:63268- 65174
Sequence
1906 bases(100 bases per row)
GCTGTCCTGACCGTCAAGCGGCTCGCCGTGAGCCAAGGTTTTGCTGTCAGCATTTCCAGCATGCGCGGCATCAGGCGCGTTCACCTCAGTTGCTCGCAAG
GAAAAGAGTATCGTGGATTTCATAAACGGCTGATACCCTTGCGAGACCGTGGAACGAAAAAGGTTGGCTGTTCGTATGAACTCGCTATCACCTTTGACAA
GAGGCTACCCGAAATAGAGCATGGTCGACGACATGTTTGAATAACTGTCACACTGGCCATTCCCAATGTATTACCAAGACAATGCTGTCGGCACTACCAG
CGGCGAGGCGCGTGTCAAGAGAAGAAGACAATATGGAGGCCATGGTCGTCCAGATGCATCAGTCTGGAGCTGCTCCACGGGTATGTGTGCTTGTGTGGTA
ATCTAAACATTCAGTTAAACGTGTGTTGTATCTATTTGTGATTTTGTATAGGTTATACTGAACCACTTGAAGGAGACAAGTGTTATTCTAAAAGCAAGTG
ATATTCACAACATCGTCCAGAAAGCGAATTTACAGGCTTTGTGTGGTAAAACGCATACGGAGGCTTTTATGCTCGACTTAAAGGATAAACATGTCACGGC
TACAGTCGCAGTGGACCAAGACAACCATGTCCGGTATCTCTTTTGGCAACCTGACCTGTCCAAGGACTTTACCTGCCGTTATCACGACGTCCTCGTGATT
GATTGCACGTACAAGACAAACGCCTATAACTTCCCCCTCCTGCACATTGTAGGCTTTACATGTACTAACCAAACTTTCTCAGCTGCATTTGGATTTATGG
ATGGTGAAGCTTTTAATGACTATGTCTGGATGATAAGCGAGGTTGACGGGATTCTCCCGCGACACCCGAAGGTTCTTGTTGTAGACTGCGATCGCGGACT
TATCAAGGCTATTTCGAAAAAATGGCCAGGCGCAGCAATCATCATTTGCCGATTTCACATTGCAAATAACATAATTACCCACTGCCGAAGGAATTTTACA
AACTCCAGTGAGAAAACTTGGAAATTGTTCATGGATCACTGGAAGAATATTGTCCATGCGCCTACGGAATCTGAGTTATGAAGCTCTGGAAGCAGCTCTC
TACAATTGCGGTATGTTTTATTTTCAGCACTCGCATTGCAATTAATGTAACAATTATTTATTACTTTATCAGGATTACAAAACTATCGAGTATCTTAATA
CGAACAAGTTTCCCCTTCGCAGTCATTGGGCTTCGTACTGCATCGATCAGTATCAGCACTTCGTACATACTGTGACCTCGCGTGCTGAAGGGGCACATGA
CAAAAACGTAAAGAGATGGCTTAATAGCGCAAGCGGTACCCTCTTGGACGTGTAAGAACGAATTTCGCGAGGCGTGGAATATAATCACAGAAAGATCAGC
GAAACTATGGCAAAGGAAAGAATCGAAATGCTCACGAACCTTCCGGATGAATTTTTACAAGGTTACATCGCAAGATCTCACGCCACGCTCTTGTGCTACT
GAAGAATCAGTACCTTCTCGCCCTCGACCGTACAAACCTCAGAGAATGCACTGGATATTACATGAGGGTCCTTGGAATTCCCTGTGCACACATCATTTGC
TGTCACATTGACACAAAAAAGCACATTGAAGTTAAATCATTTGCCAAGCAATGAGAATTGGACACCGTTAACAACCTCGATCATGAAGTTTTCGGAATTT
TGCCACCCTTTCGCCTTCAAAAGACGCAAGGTCGCAATCGGGCGCACCAAAAAACGACCAAGCGTCTACTTTCGGGCTTCGAACACGTGGAGAGGCAACT
TGGTGTCAGGAAGTGTAGCCACTGCCATGAATCCGGCCACGACAGACGCTGGTGTCCCTCGCGTGACTTCATCGAGCCTGCCGTCGACATTGAAGCGCCC
GTCGAA