Description :
From Genome Similarity Track
Location :
Scaffold_43:63256- 67194
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14410tRNA pseudouridine synthase A
Phypa_INRA-310PPTG_14411hypothetical protein
Phypa_INRA-310PPTG_14412ubiquitin-conjugating enzyme E2

Sequence
3938 bases(100 bases per row)
AAAGTATGCCTCTATTTTGTGTTTCACTGGTGTACAATGTCAACTGAGACCATGGAGTCGTCGGATGAGGACGGGCCCATCGCGACGTCCACGAGCTGGC
GCTATTGCCTGCACATTGCGTACTACGGGACGGGATTGGTGGGGTGGCAACGGCAGCAGCAGGAGACCAAAAGCAGCTCGGGCCACGACAGTGTGCAGGA
AGTGATGGAAGCCGCCGTAACGGAGACTTTGGGGGCCTCTAAGCGAGTCAACGTCACTGGAGTCAGCCGCACGGATGCAGGCACCCACGCACTCTATGTA
GGGGACTTAACGATAGCAAAAGTAGAATTATCGGGGTCTTGGATCAGCGTTTCGACTAAAGGGGGTGTACTCGTAGCAATTTGGCTTCATTCGACTCAAT
TCGGAGCTGCACATGACGATGGACGAGCTGAAGGACCGCATCAATGCCAAGTGAGTATGACATATTTATTAGACAATGAGAAAGAGGTTAAAACTTAGAC
AAAGGTGCTGTAATAGGCTGGGGAATGGTCGAGTGGTAGTGCTTGGAGTGACTGTACCAACGATGGGTCCATCACGGATTCGATCACGCTACAAGAAGTA
CATTTACTACTTGCAGCAAGGGCATCGACCAGATCTGGAGCTGGGCAAATACTCGTGGTTTCTTGGAAGAAGACTTGATATTCAACGGATTCGTGATGCA
CTGAAGTGAGTTGAATAGTGTGGATTTCGACATGAGAGTGAGTCTTACAAGTTTTGGCGTGACAGGTTTTTAGAGGGAACGCACGATTTCAGGCCATTCT
CGCAGGGGTTATTGAAGCCAAAGTACGAGGATATGACAACAGTGAGGACAGTCATCTCGGCCAAAGTGGTTGTTCGACGGTACGTCTAATATTCTCATTA
TCAACTGCGTATCAAGAGCTTACGTTTGAATGTTGTGGGCGGTAGCAATGTGAACTTTTCGCTAGACCCCCAAGTGTCCGGCAGTGGCGAGGAGGTTATT
GACGTTGCTGATATGTATCGCGAACCAAGCAATAGTATTGTTTACGATAAACACAATTCGGACGATAGCAACGCTGTAGCCACAGGTGACCACAAGAAGA
GGAAGGTCGAGCAAGCGAAAGTAGGCGCAACAGTGCATTTCGTCTGCATTGAGCTTGTGGCCAACGGATTCTTGCGGCACATGGTACGACGAATCATTGG
AACATTGCGGCCGATTGGAGAAGGTGCCCAGCCTGCGACCCGAATGCAACAGGTCCTCAATGGTGAAGTCCAACCCGGTCCGTCTGCACCGACAAAAGCT
CTCTGGTTGCATCGCACTTGGTTGACACAAGAGGAGTACGATAGAGACTGCGCAGTGGAGTGTTGCACTTTGTAGATTTGCTGAGGAATTTTTCAGCTTG
TTTGTCGTCTTCCACGCGAGCAGGTGGCACACGTTTTGCCATTTTCAACATGGAGGAGTAGACAATCCTGCCACCTTAGAATGAACGGAATGTTTACCAA
TCTTGCTTCGAAGTACACTTTCTAGAGTCATGAAACGATCACTCTATAGCTCTTCGTGAGCAACTGCAGTTTCTTTCTGTGCAGCAACATGCTCCAAGAT
TCGAGTAATGTGTCCGAGGACGATCTCTCCAATAATTTCCGGGGAATATTTGTCCACCATGTCTTTGCGAGCTTGCTTACCCTTAGCAACCGCTTCCTAC
AAAGGACATTCGCGAGATAAGATAAAAAAAATGGATCAATATCATTTCTTCCAGCGCCTTACCTGCGGATGCTCCTTGATCCGAAGCAGAAGCTCCTTCA
GGTGCTTTACAGAAGGATCAGCCCACTTATGCCCTTTAAACGCGCCTTCCTCAATCTGTTTAACCAGCAAAGATCGGTCAATCAGGCAATTGATCGGCCC
TACGAGCACCAGTTCACTATGTACTTACCTCAATGAGGCCGTCAATCTTGAGTGGATACGAGTTTTCCTCCGTCATGTACTCCGTAGTGCCACTCCAGAA
GGTAGCGATCACAGGACGTTCCATCGCCATCGCCTCGACATGCGGTCGACCCCACCCTTCACCACGCGACGGCAGAACGAACGCATGGGCAGCCTTGTAC
AGAGACGGCATGGTGTCCTGAGGAATATGTGGAGGTAGCACGTGAACGTTTGACAATTCATCAAGTTTCTTGCCGACCGCTTCTAACGCAAACTTCTCGA
TCACATTCATAAAGTCATCGGCCGACGATGACGTCGTGTGGTATCCGTTCGTAAGCAACACTAGAACAGCATCATCCTCCGCGGTGAACGCCTGGAAATA
TGCCTTCAACAGCACTCTCCATGCCTTCCTCTCCTCCCACTTGAAAACGGACAAATACACAGTCGTCTTCTCCGTCATCTTAAACGCCACCTCGCTGGCC
AGATCGTACACTTGCTTCACCTTCTCAGGATCGAAGAAATCCACGTCCACCACCTCCGGTACGACCTTCACCGCTTCGGGTCTCACTCCTCCATCAATAA
AAATCTTCTCCTGGAACTTGGTAGGTACCCAGATCTCATCCATCTTGTTCATCCGTTCGGGCCAACCCCTGGGAACTCGGTCCGTCTCGAACATGGTGCG
TCCGACCTTGTAGAGTGCCCCCTCCGGCGGACAACGGGACGTGATGTAGTGCGCAGGCTCCCATGCTCCCGGTTCTGAATGGCAAATTGCTAGAGCAGTT
TTCCTGTGCTTCAAACGCCAGTAAAAATCCCTCTCCTCGATCCAATGCTGCTCCAGCTTGGCCTTCATGTCCTCAGGCAGGTCTCGGATAAAAGCCGGGT
TGAGTGAGTCCCCATGCTGCGTGATCAGCAGCTCAAAGGGCTTCTCTGATGCGCTATCTGTTCCAGTATCTTGTACAGACTTTGGTTCGCCCTGACTACC
AGTGGTTGAGGACGATAAACTCGACATTCCCATCGCGGCGTCAACGGCCACCACGTACGAGTGTGCTTCGCTGCAGTAGCCGCCGCCGCTTAGAAAAGGA
GCGTACCAGAGCACAGCAGGAGGTTTTGACTCATTATTGCTAGGCGGGCGCCGCCCGAAAGCCGCTGTAGGCGTCGTTAGCAGTGCCTCAAGCGCGAGGA
AGAGCAGCAACACCTTCATCTCAGATATTGATACAATTTTGACGATAAAACTCATTACGCAAATTTTATGTTTGAGAAAATGTGAAAATTATTAGGATTA
TTTTGCGATCGACCCCGAGATACCCTACTTTTCGAGTTAGGATGCGTACTGCTTAGTCCACTCCTCCGCTGTCTTCTCGAAGTCTGCCTTGTTTTCATGC
ATTTGTTTAGCAATTTCGGGTTCCAGCGGGTTGTCCATGTCTGGCTGCTCCAAGATCTGCTTGATGGCTGTGAGGCAGTGCAGCACATTCAGTGTCGGGC
CCCAATTCTGCAAGTAAAACAGCAAAACGGTTAGGCAAGGCCTCACTATTCCTCCTCTAACCTACGCACCTCGTTGATGACATCGGCGCAGATCTCACCA
GACTGCGACTTGACGTTGGGGTGGTAAACTCTCGTGAGGAAGCGCACCTTGGGCGCCTTAAACGGATACTCGCTAGGGAACTGCAGGTCCAAGTTGAAGA
CACCGCCAGAGTATGGGGTATTCTCCTGCACAGCAGCACGAATGAGCATCTCTATACTTTACACAGCACTTGCTGCTTTTGCTGTCACGTACGGGGCCTG
CGAGCATTGCGTTCCAGTGCATAAGGTCGTCATCTACGGCACTAACAGTGCACCAATCGGGTGAGCTCTTCTCAAACTCGGCGAGTTCCTGTGGACAGAT
CAACGTTAGTGATGGAAGATCTGTGACGGATATTGCACTACAGCACGCACTTTAGTGAGACGACGGGCCATTGCTGCTGTGTCGTGGGTTCGCTTGAGTA
GAGGATGGTGCTTGTCGCTGGGTGTGATGCCAATCGAG