Description :
From Genome Similarity Track
Location :
scaffold_975:6325- 7432
Transcript NameFunction/comments
Pl_101689NA

Sequence
1107 bases(100 bases per row)
TCATGGCGTCGATGGCCTTCAGATCAGCACTCGGTGAAACATCCCCGCGGAAGTCGGGGAGATCTTGTTAAGAACGGAGATCATGTCCTAGCAATTACGT
TGATTAGTTGGTATGAGAACTCTACTGTGATGTAGTCTCACAACTTCTCTCGTGGTCACTCACGGTCATGGTCAGGTCTCAGTACTGCTGAGAATCGGCT
CACAGATTGATGTGTTCTGTGTAGTCAAAGGGGGTTTTGGGCGTGATGCTTTCCTCCTCGTGCGTAGGCACGTGATAAGGCATGCAGTGCAGGCATGGCC
AGCTAATAATTCATTCAGAGTTTTACTCTCAACTACACAAGCATTCGCATTACAATCTATACTTCACTACGTTAAGTAATTCCTTGCAGCGCAATAGCTG
TTAGTTGGAAGAGATGCCATGCCTATAAGTGTTCTCGGCTGGCGCCGAACGCTCCGTTGTTTCTATTCATTTGTACAATTTCCCAGTCACAAACAAGACA
ACAAGAACAAGTTAGCTTATAATTCGTGTGTTTTCTCAAGCCGTTGGTCCCCTACTCTGGCCTTAACTCAAACAACAGCCGCGGCTTACCCGACCCTGAC
TTGTGAGGCGCGCGGCGTTGGTGGAGAAGCAGGGTAAGCTGCTTGCTGGAGACGGATCCGACTAGTGTGGTCAAGGAGAGCTGCTTCCCATTTTGAAGGC
GACATCCTGCGCTCACTTAAAACAGCACGCATGCATTTGAGCAATAGCCTATTCACCACCTCTACTTTCCCATTCGCCCAGGGACAGTAGGTGGTAGTGA
AGTGATGATTTGCACCAATGCACCTTGCGAGATGATCAATTACTTCATTCTTGAAGTGGGTGCCTTGGTCAGACACCCACTGCTTCACAACTCCGTACCG
ATGGAACCATGACAACAGCGAAATTGCACACGACGTCGGGGTTAGCCGTAGAAAGAGCTACAAACACGGTTACGATGATCTGTATAGAGGTGGAAACCGC
CTGGACGCAATAGCAAATACTCCAGGTGCTTTGCCGATTCGACAATTGCAAAGGTTTCTTTGGCCATCGAAGCTGAGCCGCTGTGAATCTTCCACTAAGA
AATGCTA