Description :
From Genome Similarity Track
Location :
Scaffold_626:6324- 22092
Transcript NameFunction/comments
Phyta_totarag9762hypothetical protein
Phyta_totarag9763DEAD/DEAH box RNA helicase, putative

Sequence
15768 bases(100 bases per row)
TGGCCAAAAGACGTTGGTAGGCAAGAGATCGCTAGCTACCTTGGCAAAGATCATCAGGGACTGTGgacaagatgctgcaggagaGTTTGGGAGGCGGTGG
AGAATCTGCTGCTAGCGCGAAGAGAGCGTTGGCACAAGTTCAGAAATTGGTGCAGCTCGCTTCTATGAGACCCAAAGCACTAACCCTGCGTGAATTTCGC
GACGGATTGGAGGTAACGGCGTTGGCGATCTATCGGTTCCCTAGAACTTTGTCAGACAACGAACTCTAACCTTGTTGCATGGTTTGTCCGCATACAGGAA
TGTCTAAAGCCAGAAGGGAGCTCCACCATGAAAGTTCTCGGATTTCAACTCGCTCGGATCGCTCCTGGATGCTCCACGCACGAAGTCTGGAAATTCATCC
TGGAAGCAGTTGTGACGGAGCTGGGTAGTTCCGAGAATACATTAactttggctgctgcagttccagTGCTCGGAGTCATCCCGGTACCTCTCGTGCTTGG
GTTCTTGCTGTCTCCTGAAAGGGAACCCATGAATAAGTTGCGTACAATTCTGACGCACGAAGACATTGAGGTTCGCTGTCGCGCTATCGAGACGCTGTCA
AAGCTAACGCTGGATGTGGCGATCACTGTCGCTGGGGACGGATTATTTGTCTTCCCATTCGAGTCGCACGAGGCACGAATTTGTTGCCAACAAGACGTAG
AGACGATGGTGAAcgactgctggaagttgATTTTCCACACTCTTTCCTTCGACGGACAGTCTCAGAGTGCTGCGTGGTCTGCCGGCACTGCGTTTACGGC
GTTAGCGAGCCTGTTTGCACGTTCCAGCACGATGGCGCCGTTTTTTCTTAGCATTCGAGAATCTGTCCGCGTTCAAGCCCCAATAGATGATGTCGCCTCC
ATGGTATACAAACAGGCATTCCCGCGAATTCGAGCGCTGGTTGCTGTAGCACGCACCCTAcccatgaagcagcaggcggatGCCATGTTATGGATCTCCA
TGCTGTTTTGCACGATGATGGAGCGCAGCGGCGCGCGATGTCCGAGCGTGAGTGTGCCGTACATGGAAATTGATACCGAGGAAAACAATACCGACGGCgc
cgatgatgatgacgatgagcCCCATGCTTCCACGGAGCCCGTTCGAGTTGATGAACTTGTGAGTGATCTGCTCGAGTCCTGGGCGTTTCCTACGGTATCG
AGACGAGTGTCATTGGCACAAGCTACGAGCATGTGTCGTGCTATCTTCATTCTGTTGGCTCACCCTCTACAGACATTTACTCGTATGCGCTGGGCTGCTC
AGCTCGCCAACCACCTCATTGCACAGTGTTATCTTGCCAACAAGAGTAACGGCAACAACAGTGGTGCGTCTAATCCtcagctcaagctcaagctcgagCT
TTGTGTCATGCTCATTAAGACGTTTGCTTGGTTGTCCGGTGTCAACTGCCAGTCACTTTTCGTGCGTACAACTGAAGCGCTCTATCTTCTGAATCAGGAA
AAAGATCGACGTGATCTCGTACAGACCCTGATGGACACGATTGCCGCACATGTTGTCGCCAACCGGGACTTTCAACTGCTCCAAGGATTGTGTACAATGG
CGTTCTTCAGACAACCAAAGGGATTTTCAAGATTGTCACCACGCACCAACGGCTCTGAAGTGTTCCGAGCGCTTTTTCAAGCTCTTTTCAATTCGACGGA
ACTGTCCTCACCTTCTCGACTCAGAGCTGTCGAGCATCAAGTATCTCAGCTTATTGCCTTGAGAGTGTTTCGAGGGCTTCTACTACTGAAGTTGGGGGGA
TCAGCTACCACTTCACCGAAGGCGTATCGTAGGTCCTGTGAGATGAGCGAGAACATCGTTTACTATACAGGTCTACTAACGTCACACTTTCAGGGCATGC
TAGCCTGCCCCGAGCTGGCGCTTCGCGAATCGCTCGAATTTTTCCAGCACGAACTGTTCCCAACCACGGACCAAATTGCGTCCCAGAGTGCTCGCCTCCA
GATACTTTGGATCGGCGTTCGTCTGTATCGCAATTACTCCTCTCATGTTCCTTTTGACGCTCTGGTGCGGGAGCTTCAGCGTGAGACTGACCGGTTGTTC
ACCGCTATCTGgaatgacgacgacgaaatggAAGGCGCAACTTTCGACAACGGTTTGCTTGGGTGTGGGGGTGCTAGTGAAGAGGAAACACCATCGAGTC
GTAAACGTGCGGGTGATGCCAACAACGTTGACGCCCTGATGGTACTTGGCGACTGCATCATGCTGTTAGCGCAATTTCAGCCCCATACGCAGCCCCAGTT
TCTCCAGATGTGCGAAAAAATGATCGCAGAGCTATCGATGTCAGGGAGTTCTCCAACGATAATTTCCCAGCAGTATCGTATGTACGTTGACGTAtatttc
tctctctctctctctatGATGTTATCATGGACTAACTTGGTTAATTGTGCATGTCTAGCATCGAGGATGTTATGTCACTGTTGTCGACCCCTGCACCAAT
AGATACACTGGTGTTTGAGTCCCAGTTCTCGAAAGAGATATTTGACCCACAGGACATTTTCCTTCCTCGGAAACACTTCTACGAACATGCTGAAGCAGGT
AACccacaagatgaagaatATCGGGAGTCGATCACTGTCACGGGTAGTGCTGACCCTGTCTCCGTCCGGATCGCCCATCACCACCCTCTCTCAGGAAACG
AAGAGGTGGTTGCTCTCGAGATCAGTTGCTGCAACCTCACTACTTGGCCACTGAATGATCTGGAAATTCAGCTTCGTCCGCTTGGAGGCGTCGGTGTTGT
TCAGTGCGTGGACACCAATAAAGACTTAAAGCTTCGTTTACTACGTGCTGATGAGACCGTTAGCGTTGGTACAAGCGgaggcagcaccagcttACCACCC
TTCGGCGTGATCAAAGCTGAAAAACGCTTTCGCGTGTGCAAGTTCACCCAGGCCACCTTTCTCGTGCAAGCAGTGCTTGTCCACGAGTCCAGTcaagatg
gcgacgatggTAGTGGTAATCCTGCAGAGGAGGCGTCCGCAACTCCAATCCGTCTTGCATTCAGTAACCGCTACGTGCTGCATTTCGACacacttcttcg
actgccACAGCCTCAGTTCGCTACTGCTGCATTCTTCCAACACTGCTGGCAAAGGTACGATTTGTCAATTCAACCTTCTTTCATACATTGTGTCGTATTC
TTACCATCACTCGACACTATGTTTCCGTTCTAGTGCTAACTCGAGCGTGCTATGGCGTGTCAAGTCGCAAGATCCACAGGGAGGTAAACTCGGGGTTTGC
CAGCACACGGTCCACGTTATGAATGCCAAGGTTGCAGCTGTTTCCGAGCTGTTACTCGAGCTACCGACGCACTTTCACGTACGTCATTCCTCTCCACCTC
AATATCCATCCAGGCCATGCACTCACTTACTCTCAATTGCATTCACCATGTTTTAGATTGCGATGCTCACTCAGACGAGATGGGGTTTCTATGTGGTCGC
GTCGTTGACAATGAGTCTCGAGTCGGACTCGGGCTGGTCGGGCATTCTGGAAGTCCGGTCAACTCGTGAAAATATCCGCGAATTCAAGAAATGGCCGAAT
GATACTGTTAATCTCTTTGGTGGAGAACAAGTGCAGCTCTGCAGTTCACCGGTGGCACTTTCTATCGCTCATGACAACATGGAGCCACTCAGCAGCGCTG
TCGATGTCCCAACCTCCTTCCCAACCGCACCATCTCCATTCGATAACGCATTCTCAGCTCCAATCCCTGCTCCAATGCAGTCCATCGCGACCGAGAACGG
AGTGCCTGCTGGAATGCCGTTCACCAAGCAAGAACCATCCACGACAACCGCAACTTCGACCTTCGCGCCGGACGTGAGATCCACCACATGCTTCCACAAA
GACGTCAGCACCCCCACCGACCGAAAGTCTTCCTTCACACGCacccagcagctcgagcaaaCACGAACCCCCGAGACGACTCACTCCCCCGACGAGCAGT
GGGGGAAATTCCTTTAGCCAAACTTgaagacaacttcaacttgatgtATCTCACACAAATTAGCTCGTCAACCCAACCCAgctctcattggccaaaagCC
GCGTTAAATCACTTTACGCATCAGATTCTAGATGCGGCCTTCGGACCAGCAACATGGGGCTCCTGCCGTGGACGAAGatgcggacgaagagcgcgtGTAT
CGTCCGCTGCTATTCCAGTCCACAGGCTACGCGTCCTCGGAGCTTTCCCGCGACTCGTACGAGATGCACTCGCGTCTTCCgacggcatcgtcgtcaaccG
CGCCTCTATTAGGGATAGAGACTACTGCCACCGACTCAGACGAGAATCAGAAACAGAGACATGTATTCGAACCACAGATTCGATTGGAGACACTGTCGTC
TCGAGCTGCTACAGCAGTGCTCTGGGTCACGTACTTGGCATTCCTGTTGGCGATGGCTCTGCCCTATCTACAGAGCAAAGGATACCTGGAAACGGTGGGA
AGCTTAGTAGTAGAATCATATTTTGATTATGATGGACCATTTTCTGATTCTGATACTGTTTGTATTTCAATATAGGCGGTTATATTGCCAGGAGGAGTAT
GCAAGGATGAAGTGAGAAGAGAGCCGTGCATTAAAGTAGACAAGACGAGAAGTATTGCTCAGTGGGCAGCCTATGTGGCCAATGTGTCGAGATACACTGG
CTCCATTGAGATAAAACTTGATGTTCGGGAGCAGGTGAACGCTTCAACATTAGTGGCATTGATGTCGTCGGTAGGGGAGAGTAATGCGTTCCAGGAATTG
GCACGTGTGGGGACTGCCTGGAAGATGGATCGAGATGCGAACAGAGTTGAAAACGATTTAGAGGACGAAGCATCGAGTATTTCAGAGGTTGaggatggag
aagctgatcaagACGCAGGCTATGTATTGTCCTATGATGCTAGACTGTATGGCATTGACCACGATGTGGCCCCGGTCGCGAAGGATCTTGTCGTAGATGA
ACGCAACCAGAGTATTTGGGTGGAGTGCCGAACAGGTGGACCATGTGAAGTTGtgaggctgctggagatAACGCAAGACGTCGACAGATTGGTAAGAACA
AACTTGTATTTACATGCCGTACAGGGTATTTTATTTGACTAATTTGTGATGCGTCGTTTTCTACAGGGTGGAAGTGGATACGATGCGTATTTTGCAGTCG
TGACCTTCAGAGGGCTGTATCCAAATGTGTTCGGCAGGGAGGTGGCTTATCAGTTTGCGTATACGTAGGTGTTGGTTACCTGCTTGTTTGTATTTGTCAG
TGGATGCTAAGTTCGTTGCTTGACGTTCTGCAGAAAACCAGCTATTCACGTAGGCGAAGTCGTTGTTCGTGGAGTACTGGTGCTAGCATCCATATTGGCA
CTTCCTTGCTGGTTCATCTCGGTGCTAAATTTTCACGGTGGATCATGGAGCCAAGTGCTTACCGTGCAAAAGTGGTTAGTGGGCATTGGGGTTGTGCTCG
TGCTTTTGCAGAATCCTGTGTACGCAATATCTGAACTGTACACCTCCGTGAGTATGCGCACCCGGTTTGTGTCGATCACGTGCCAGTCATTCGCGGAGGC
TTTCTTTTACGTGTTTTGGTTGAGCCTTATGGACCAGCACGGCGGAGATTTTTCCTCTCGAAGATGCTCATTTGCTCCAAAGCTCATGTTTGGATTGGTA
CTTTTTGGTGTGGACACGAGCATGACTGTACTACGAATGCCCAAATTGTTTTTCGGGGTGGAAGGGACGTCGTCTGCGCACAACTTCCTCCACGAAGAGC
TCTATGTACTTCTTGGCTTTATTCGTACGAGTTTGGTTCTGGCTTGGCTCGTATGGATAATGGCAGTTGGGGCGCGATCGGGTCGGCATCTGAAGGCACT
GCCGTACATGGCAACTCGCTTCAAACAACTATCGTACCGATTCCTCGTACTCGAGACGCTTCTTGTTTTCGTCTACGTGTTTATACTTTCAGCTCTTCAG
ATATTTTACCTGACCCAAACATGGTACTTCATTGGCTACGATGCATTCATCCAGGATGCAGTGCATACATTTGCCAAGATGCACACTGGACACCCGTCGC
TGGGCAAGTTCCTGTTCTTGTCGGTGTATGTGTACCTTGTCATGTTTGTGCACTTGCCTCCGCTTGCGGGTGACAGCACGGGTTTGCTGGCGTCCACAGC
TTTCCACGTCGACGAGAAGCCACGAGTGGACTCTTACGGCTTTCTTACACCCGATTCAAACTTATTTTGCGTGGAAACGGCTGGATGGCTGCTTGAGTTG
GCGTATCAAGCTTACTTCGACCCCCCTGGATGTCCATCATCGTCTGGGTATGGCGAACTCACCCTTGAGCGATATGGTTTTGAGCTGATCACTCATCTGC
GAAGCAACTTAACGGATACACATGTAGTCGTCGCGTGGAGTCAAGAGAACCATCGACGCTTGGTCATATCATTCCGAGGCACCACTAGCAAGGAAAACTG
GAAGAGCAACCTCCGAGCTGACCAAAAAGTGTTGTGGATGAAATCTCGAGGACTGCGCTGGAGAAAGTCTTGTCTGGAAAAAGTGAAGGACTTTGCAGCG
AAGATCCCCTTGCTTAATATGGCGTTGCCGCGAGTGCACCGAGGTAACCGGTCTTGATCTGACAGAAATGCTAGTTTACACGAAGGGAGTTATCTAATGC
TTTGTGCTTTTGCCGTGCAGGGTTTTGGATTGCGTACGAGTCGATTCGTGATGAACTAAAGGAGGTGACACGGCTCATCCTGGACGAAAACCCCGGCGTG
TCAGTGTATATCACCGGACACAGCATGGGCGGTGCGCTTGCAGTTTTAGCCGCCTATGACCTCGCGGTGAATTTCAGCATCAGGGTCAACATGTATAACT
TCGGTGGTCCTCGCGTTGGCAATCCAAGCTTCCGTCAGCACTACAACAGCTGTGTTCCCACGAGCTACCGGGTTGTCATGGACGGCGACATCGTACCTGG
GTGGCCAAAATTTGTACGTATCCGTAAATTTCTGTTGTGTTGAGGGGAATGGTTTACTCAACGCTACACTCGCTTTGCTTCCGCAGTGGGGACTCTACCA
GCATGTGGGAAAAGAAATCTCGCTTGACGTCGCGGGTAACCTGATTGTTGACCCGAGCTTCGTGGAGCGCCACCTCCACAACTCATCGAGGCGCAAGACG
ACAATGCATGGCACGAACGTATATCGCGTGTCGATCGCCAAGTGCCTCGAGAATCTAACGACGCCGTAATAGACTCGCGGAGGCTCCACGGCGGAACCCG
CGCATCTGGGCACAAATCTATCTATTTGCACCACTTGCTATGACATAAACGTTTTGGTAGCTTGTGTCTTGGGTGGCGTCTGTATTCAACCAAGTCCCCA
TTGCAGCGAAGCGTCGCAATCCGTTTCGGACACCATGGGTCCCATGATGGGAGGCGTACTGACTTCGTTCATTGTTTTAGAAGAGCTTACAAGTGCTCTT
AGATAATCAACGCGCGGATCAAGCACCACCATGGCGGATGTAGACGACCAGCAGGCCCAGGAAGGAGTGATTCGCTCGCATGTTGACCTCGCGGAGGCGG
CAGCAAATGGCTCGCGTGCAATGGTGTGTACACAGAGTTAGCACCACCTGCTTTTTGATGGCAAAGCTTTTCTAACGTGGTTCTCGCATTCACTGCACCA
GGTGGAGTTTCTTCTGGACAACGGCGTGCACATTGATACACCTGGAAAAGGTTGGTTCCTCAGTATTCATAAAGACCACATTGAAACCCACCGCAATGCG
GGAGATAGAGTTGACATGCCTTGTAATTTCTCAATTTGTGCGTTATCAGATGGAACAACGCCACTATGTGCCGCAGCTCTGTGGGGGAACGATACCATGG
TCGCATACTTGCTCGACAAAGGTGCCGACGTATCTGCCAGAAATGAAGGTGTACCGCTCAGtaatttcttcttcatttttGTTCGTAGTGCTGCATGAGT
TAAACCTACTACAGACTAACAATTTCTACGCTTTGGTAGGCACGGGGTGGACAGCTCTGCACGCGGCCTCATTTCAAGAGCACGGGAAGGTCGTGCGCAT
CTTGTTGGCTCACCAAGCCGATCCAAAAATGGTAGACGCGGAAGGGCGAAGAGCGCTGGACtacgccagcatctccgagGCTATATGGCCCTTCTTCTCG
GGTAAGCCGACGCCTTGGTTATTGTCACGATTTGCCTGTATTCTGACATGTTCTGCTGCGTTGCCTCGTTTAGCGCAAGGCTGCATCAAGAGTCTCAAGT
CGGAGCTAGTCGCGAAAGGAATCATCCGCAAAATCCTAGACCAGCCCGAACAGACGCAGCTGAGTGACAAATATTCTGACAGTGTACGTCCTGCGTAGGA
AAGCTGTTGTCATACTGCATTCTCACTTCCTTGTTCATGTTTGCTACTGGTACTGCAGATCTCGGCCTTCTCCCGCCCCGGATCTGCCTACACGAAGGCA
CAGATGTACCCGCCGCtagctcgtcgacagagCACCGCAAACAAGGTCAGCTACGCTGCTTTTGTTTATTCGTTTGGTGGCTGTAGATTAACAGTGTCTG
TCTGTCCCCCATGCCGAATATACAGTCGCGTGACGGCCGAATTCTGACGGGGCCCATTGACCCTCTCGGCGACATGCCAGTCGAATCCGAATCGAACCAG
CGGCGTCCGTCCCTGAAGAGAATGGGCATTTAGCTGCACTGGGCGGTTGTCAGAACTCGTAGACCGCGACGGTCTTTGCTTCCGCAGCCAGCAAtgcacg
ttgaagtgctggtGCTCTTTTTTTCGACCAATGAATACAATCATCGCATAAAACGCACTGCAGTAAAAGATGAGTTGGATCAAATTAACCGAAGTAAATG
GCTCAGAGTGGCTGTATAGACCTAACTATCGCCGAAATCAAAGTAACGATTGGCTCCTTTGATTCAGTTCGGCATAGTATATTGATACAAGCACACTTAT
TCCAGTACACTTAGGAGATCTGGCGTAGGCGCCACAggattggctgaaattgGTTTATGCGCTATAGAAAAGTTACGCCAAGCCTTCCCCTGACCGCTCG
TTCGAGTCCCCCTCGGCCGCTCAGTTCTTGTATCGCTTCACCGCCAGCACGCCGTTCTACAATGGTGAGCACTGCACCGCcggaagctgaagcggaAAAT
CGCCACAAAGCAGCCAATTACACCTACAGCAGACAGCACTAACCAACTCTTCTCTTCGTGAACTGATGCCACCCGCAGTCGCTTCTTAACAAGGGATCGC
GCCTCATGACCCAGTCGCTCCGCGCTGGCGCCCGCACCATGTCCAGCGCCACCGAGCAGGAGGCCAAGGGTGCGTGCGTTGTCTATCTCCACTACATCAC
ATGTATCAGTTCTCTGTGACTCTATTGGATGGGATGCTGACTGTGTTGCTGCCTTTGATCAGAGCAAATGCACCGATGGACCACGATCTCCAAGGGCATG
ATCGGCCTGGTGGCGGTGTACACGGTGTACGCCATCAACGACCACCTGAgccacgagcaccacgaggaGGAGAATCCGGCCTACCCATACCTCAAGATGC
GCACCAAGCCCTTCCCGTGGCCCGAATCGGACTGCGACCTCCTGGACCGCGAGTGCCGCGCCAAGGCTCgcgaggcgaagaaggctCTTGAGTAAGCAGT
GCGAGCCACTACAGTCTCAATGGGGCAAGAACAGAGCAGACAGACTCATCAGCcaggtggaggagaagggAGTGGGCTGACTTGTCAGTCTCTTattctt
gttcttctcttTCTCGTTTGTTCCCTACATGGACCTGCTGCTTTGTCGCCTCTTGACTGCTTGATCGCTCGTCGGACTTGAAAACTCCGCTCACACCCAC
ACATACACCACAAAGTCAAGtgaaaaaataaaataaaaacaCAAAagaagtcttcgtcgtcgttaTTAACCCCTTACCAATTGTGTCACTACCATTCTCG
TACGTACTGTACCTGGCACTGTTGTCTTGGTGTCGTCCATTGCAGCACCGACGGTATGGCCCTGGAACTTCCTGGGCCGAAGTGTCTCCATGAAGTCGCA
TTATGTGGACCACTCACGCATAAAGTGACCTACACAGTGAAAATGGCGGACATCATCGAGCACCGCGCTGCCCAACGCCAGCCTCAACCTGGCGAGCCTG
TGTGCGTGGTAAGACACTGCAAGTGCATACAGCAGTGAATAAACTGCATACACTGCACGTATTCTAAACTACTAAGTATTCTCCGACAGATTTGCGGTCG
GTACGGCGAGTACGTGTGCGAcgccacggacgacgacgtttGCAGTCTCGAATGTCGCGACGTGTGCATATCCAGACATCTTCCTGCAACTCAAGAgtct
cagcaacagcaacagcaacagcaacagcaacagcaacagcaacagcaacagcaacagcaacagcaacgatCCGATGAGCTCCGACGGAAATTAGGCATCA
AAATCTCTGTTGTCAAAGGAAATGCAGAGCAGCGGTTATGGCCGACCCCGTTCGTGGACTTTGGGCAAGAGCAGGAAGGTGCCCAATTGCCCAAAGAATT
AGTGACCAATCTCAGCGTCAACAACTTTGAGAGACCGACGCccgtgcagatgcagacgatCCCTTGCGTGCTGCAGGGGCACACTGTACGTAGTACGTCG
TTTGGTGGACTGAGTGGAGGTTGGGAGCCTGATGTGGTGACATTGTTTGCTGTTTTATTCTAGGTGTTGGTGAGTGCTCCAACTGGGACGGGCAAGACGG
CGTCGTACCTGATTCCAGTGATCGCGCAGGTTTTACTTGCCAGGGAAggagagcaggaggagatcCTGGCGTTGGTTCTGGCTCCTGTGCGAGAGCTGGC
GATTCAGATCGAGACTGTGGCCAAATTGTTGATGCGAGGTATTGTTGATATGAAGACAGCCTTGTTGGTGGGTGGGTTTCCCGTTCCGACGCAACGCTAT
CGACTTCAAGGCGGAGTTCAGCTGATTGTGGCTACCCCTGGTCGGTTTCTTGACATTTTCACAAGCTACAGCGGCGGCGATGCCATTCTGCCGGCTGTTC
GCACGTGTGTTGTCGATGAAGTGGATATCATGCTGGACGTTGGCTTTCGACCACAGCTTTCGCAAATTATGGCTTTGTTGGTTGCATTTGCTGAGAAACG
CCGTAAAGACGTCCAATTGCTTTTCTTCAGCGCGACAATATCGGACGAGGTCGAAGCGTTGGTGCAGCAGATTTTGAAGACCCAAAGCAATCGAGCTTAT
GTTCGCATTGATATTCGTgacgatgacagcgagaCAAATACGGCCACTGGGATGCCGAAATTTTCACTAAACGCACGTGTTCACCAGCAGGTTAGGTGGG
AGGAAGACAAGACGAAAAAAGTCGAGCTGTTCGAGTTCTTGAAAGGAAAAGGAGAAGAGTCAACGGTGCGTACAGACGTGCGTGGACCCTGTCCAAATCC
TGAGTGACTTATGATGTGGTTTATCTGTTACTGTTGCTACTGTaagctcgtcttcgttggATCAAAGCTTGGCGCGACCATGCTAGCAGAAGCGATTGAA
AAGCGCTGTGGAATTGGTGCAGCGGCGATTCACGCAGATAAAACTCAGCGAGAAAGACTTCGTCTGCTAGAGGCCTTTGTGAATTTGGAGATCCCTGTCC
TCGTGTCCACAAACGTGCTAAGCCGAGGGATGGATCTGTTGAACGTGGAAAACGTGGTGGTCTATGACTTCCCCAAGAAAATTACTGACTACGTTCATCT
TATTGGTCGTGTCGGACGTGGAGGCGATGCGACTGGAAACGCTCTTACGCTCGTGAATCTGGAAGACCGCTCACTTTTCCGGGGGCTTGTCCCTTTGCTG
CGCCAAGCTAAAGTATCAGTGCCCCGAGAAGTGTATCAAAGCATTCACTCAGAAGATGCTAAAAAACGTGCTCGTTCCAGTGAAGCCGCCGTGATCGATG
AATCCAAGCGGGCTTTCCGAATTCGACAGCAAATGATTGAGGACATCGGCACAATAGCATCAGAGTGGAAGGAATGGGATAATCACAGGCGTAAGCGGCG
GAAGGCAACGTCGTAACTGGTGAACCACGAACTCGTCAGCCCTGTTGTGTTGGGCATCTCAAAATCGATAAAAGTGCTTCAATGGGTGTGTACTGCACCT
AGCGCCGAGAATGTTGGACCATGGTTAAGCACAGCTGGTGCAATCCAGTCTCGACGGTGGATTCGCTCCCGCGGTTTGTCTCGACGTGATTTCTTagcgc
cgccacctcgtAAGTGTTCCCTGGGAAAATAATTGTTATAACAAAGTGCACCACGGATAATCGCGACCTCCGTCTTTAACACCATGGCGAGGCAGCAGAT
CAGACGTGGGCACTACAACGACAGAGTTACGACCCGGGTGCAGTAAACTGGCATAACACGAAGTACTACTGGATGGTCCCAAACTACTCCATCGTAAAGG
ATGGCGTCCTGCAGAGATTCGTCCCCTACGAAAGATATGCGGTTCATGATAATTAGGTGGCCTAGAagcgacagcgccaccacgGGATCTGCAAAGCGTA
AATGAAAGCGCAATTTGTCTCTTATAACAGGGGTGAGAGCATCAAGTGTGAGGGACCACAGAAACCAGATCGCCCACGCGAGCACCAACATACAACGAGA
TAGCTCCCAATTACTCACGATGCACATGCTCAGATTTGCCGCAGTAATCTGGAAGACGTAGAAGATAACATCGAACGAGATGACGAGTAGCTTgagaagc
tgccgctggtAAAAAGCTGTGAATGGAACTACAATGGACAAGGTCCACACAGCAGTGCACTTCACGCTTGAAAGAGTGAAATAGTATCAGTTCCGCTAAA
TCCGCTGAGAAGAACTGAGAAGAGAGGACCGAAGGCACCAACAGCATAAAGTGGCAGCAGGTACCATGCTGATATGGGCTCTGATACTCGCAGCGGGAAA
ACTGTGTGACTTGCGTTGAATGTCTGATAAGTTTTGACGAACCTCATCTTCTGGACGACGTTCGTCTCGCGCAACATCACGTTCCTCGTATTCGTACCGA
CTGCGCGATGGCGAGCAACTGTCCTGCCCACCTGCCTTTTGGTGGAGGTTGCAACTGTAGTGTGTTGGACTTGCACTAGCTGCAGGGCACATCTGTAGAT
TACACACTGAATGGATGATGAGCTCTGGCTTGTCCGCAATGCTCTTTGCTTCCTCACAGCTATCTTCGTGATGAACAGAGCAAGTGTCAACGATTCATTT
TCCGATTGTGTCTACACCGGTGCTCGTTTTCGTAGTCCAAGATTGAAAAGCTGGTGTATCCATCCACATGGCCCAGCATGACCCAGACAAGCATAAAGAG
CACCGGCGGGATTTAAACGGTAATCATCAGTTCAAACTGCCGAATCCCTCGAACATGAGCATCAATGCAAACAATATGATGGAAGCCCACCCAATCGATA
ATCATACGAAGGAACCGCAGATCTCTGAAATGCGCCGAGACCATTGCAGCTGCCATACTTGTAtcgaaggagaagaaccaCAAGTCAAATGTCCCCATGA
GAAGCCGGACGACATCATATCTCAACGCCCCGAAGCCAAGCGGTATCCAAAGGAAAATGCTGATGAATGATAGAAATTGACCCGTTCGCGCACTTACCAC
TGCACAAAACTGATCAAGAAAATGCTGTCACATTTGCTAGCAATAACGGCTGACGGTACCTGCTCAGGAACCGATGAATAATCTCGTAAACTTTTACTGG
GAGGAGTTCTCTCTGACAAACGTGGATATATCGATCATTGGGCAGTGGTTTCGCTGACCGGAAGACGTATAGAATCTCGCAGGCTCCGGCGTCACTTGTC
ACGATTCTGTTTTGTGTTATTACTACAATGTGCGTCGGTGTAGAAATTTGGTCGGAGGAAGATGCGGTGGACGTTCGAGTACTGTAAATACCACGTTGAT
CCACCTCATGGGAGTCTGTAATTGAAATTGTCGTGCGGCTGGAGTTAGGGATCTGGCTGAGGCTGGATTGCGACGAGAGATTTCGATGTGGGACCACTTC
GGACCCCACCGTCAAGCAGCCCAGCTGGCTCAATACGGTCCCGGCGAATTGGATGCAGTGTTTCCCTGAATCTCCTTGGATGTCCTCCGCGCGAATGCCG
ACGTCCTCGTTTGGCAAAGTAATTATCGTAGCACACGCCACCGCGGATAATGGTGACCTCGGACTTCGACGCAGTGCTCAATCTCCAGATCAGACGTGGA
CACCACAGAGATAGTGTCACTATTCGACTGAAGTAGAAGGGCATTGCTCGAACAACTAGTTGGTGATCCCAGATAACACCCTGATACAGTACTGCGTCGT
GCAGCCGTTCATCGCCCACAAAGAAAATGCGGCAAATGATAGAAATATGCCCCAGAAGTACGAGTGCAACTACAGGAGCTGCCATACGAGGTCGAAAGCG
TAGTTTGTCTCTCATGATAGGAGTGAGGGCATCCAAAGTCAGTGCCCAGTGGATCCAAATCCACCATGTGAGCTGCAACAGGCACCGTGGGCGATCCCAG
TTGTACAATATGCAGACGGACAAGGTCGCCGCAGTGGTTTGGAATGCATAGAAGAAGAAATCGAAAGAGGTGACAAGAAGCTTGAACAGTTCTCGTTGGT
AAAGGGCTGCGAATGGGACTACGAAAATCAGCGTAGACAACAGACCACCCCACGCTTGTGCACTACCAGTACCCCTAAAATCGTAGACAATCATGGAAAA
TGAAAGAACGACACCAATGACACCAACAACGTACAACAGTACCAGACTACTGCCTGCAACACGCAGAGGAAGTAAGACGTGGTTTGAGTTGAACGTGAGC
GGAAACTTAATGAACATCATTTGCTGGATCATGCTCGGTTCACGAGCAACATTTTCGTTTGGTTCGgacgcagcaacaacgtGTTTCCTTGCAGACACAC
TTGGAGACCGAGCTCTCCGAGCATGTACAATAGTCGGCCGGTCAATTAGCTCGAGTTTCAATCCACATCGGTAGATAACACATTCTATCATCGACGATCT
CTGCCTGACGCGAAGTGCTTGGCGTTTTCTGACGACGATCTTCGTGATTAACAGCGAAAGAGTTATCATGGCGTTCCCAATGATATCCACGCCGGAGAGA
CTGAAGTGCGTGTGCTTGTTTCGATGGTTCACGACAGAAAAACTCGTGCAGCCATCTAAGTGATCCAGCATTATCCAAAACAGCATGAAAACAAGCGGCG
GAATGCCGAGGACAGTGACAATAACGAAATGTCGAATCCCCCGCACTTGACCATCGATAAACACGATGTTGTGAAACACGATCCAATCGATCATCATCCT
GCAGAAACGAAGGTCCCAGAAGTAGGCCGAAATCATCAGTGCAGTGAGTGTTGTGGTACAAGAGAAAAACCAAAAGTCGAATGTCCGCATTACAGGGTGC
ACGACGTCGTATCTCAGCGTACTAGAAGCAGGCCCATTGGGAGCCATATCGAAAGACTGATCACCGACAAGATTTGGCCTGTTAGTGCGTCGACTCCTGT
CACGACAATATTCAGAACCATCCCGATCATGTTTGCCAGCAATAGTGGACGATGATACTTGGTGAGAAGACGATGAATAACTGCATGAGCTTTTGGTGGA
AGTAGCTCTCCTCTGACGGACTTGGATAGATCAATAGTTGGAAGTGGCTTAGCAGGTACAAGAGCGTA