Description :
From Genome Similarity Track
Location :
Scaffold_239:6320- 11752
Sequence
5432 bases(100 bases per row)
TAGTCCTTCCTAGTTCCGTGCATTCACGAATTCCTCAAAAATAAACTATTTTCCCGTCAACACGTGGACATATTCGTGTTTTGTCATTTGTATGTATTAC
GCTGCTTTATGTAAGTTGCGAGATCATTTAAACTTTTTTGCACTGCATGCAGCCCTCAGCAACAAATCGGTGAGTGACATTCGCGTGTCATTATCAGAAT
ACTAAAGTCACTCTCGACCTTTCTGGTGTTAAGGTAGGCTTTACCGATGCCGCCACAGAAATCGTGCAGGTAGATTAATCGGCATTGGACCAGACGCCAG
CCCTTGTCGAACGAAGTGTTGACGTCATCGCATTTTCCGAGTGCAGCAAGCAGTTTTTCAGTCTGCACGGCGACCTTATATTCCTGGAAGTCGATCTCGA
TGCCGGCAATCGACCCGTCGTCCCAGCACGGCTGAAAACGGCCACAAATCGGAATACGGTCACAAAAAATTGGGGTGATAAGGTAAAAGGCAGTGCGGGG
GAATGGATGTAGGTCTTTCTCATTCAGATTGTCTTCATTACCCCCCCCCTCCCGCTTTGGAGATTGCACATCTTTAGACGATGGCGGTGATTCGGTACGC
AATCTGGTATCAGACGTCGGACTGAGAAGCTCGATCAAACTTCTCAGATAGCTTTGTCACTCAGGTCCCCTGTTCGGGGACAAATATAAACGGGCTGTTG
CAGCTGACGTAAGAACGGCCCATGGTGGAGACTTCGTCAGAGTTAAATTATTTTCATTTATCGGGCCGGACGCATCAGACAGAACGTAAGGTGAGCCGCA
AAGAATTCAAGCTCTGGCTTTTACTGCGACACAATCATCCATCGGCCCTAGCAGCTTCCCAAATGTGATGTTTGTTTTCTGAAGAAGCACATAAAAGACC
GCTAGGATGATCCACCACTCGGACAATGGCGTCTATTTCGAATTGATCTTCTCGATTATCACATGGAGAAGGAGAGCGCGGTTGACGAGCCCAAATTTTG
TCAAGCTACGGTACGCCAAACATTTCATTGTCAATTTCATGCTCTTGATCCTCATCTCGGTGATCTATTGTCATGTTTCCGCAGCGGGGACGCGATGTGG
TTGGCTATCACGTGGAAACAGCCCACAAGGTCAGCGAGTACTACATTTTTAACCTGAAATCGATTTGGTGAAGCCTGCACTAAGTAAGAATGAGCCGAAA
CGAGAACTCCTGATCAATTTGCGTCACAACACCTGAGTCGCGCCCAGTCATCTTATTTTCGCCATCTGGCCCGTAGTTGAACAGTTTTTAAAGCCAAATC
GAAACCAGCGCGTTTGGAAACTCGACCAATCAGCGGGCCATGTTGTTGAACGTATGGAGATCGAATATTTGGAAGGCGAATCCGCGTAAGTTTTAGATGA
TACCGTTAAAGTGGAGCCGGACGCGTTGGTCAAAGCAGGAAATGCCTTGGTGCGTCGAAGGGTCGGTCGCAATCAAAAATGCACAAGTAAACGATCGAAT
CAGGATTTTTCTGATCACTTCCAGTTCGAGAGCGATGACGATGCGGGAGAATTCGGATACATCACTATAGATGAGCTACCGAGCAAAGCGTATCTTGTCC
TCTCCTTGATACGCGACCCAACCACTTTGAGTTGCCCGAAGGACATCGACAGCGCGATAAAATTGACCGCCAGGTTGAACTACAGCGATTTACAGATGAG
ACTCCAGTAGAACAGGTCGTCATTCCATTCATCCGCAGAGGATTCCTCGAACAGGTTCCTAAAGCGCTCCATGGTTGTCTCGATCAAATTCCGTACACGT
TCTTTGACCAGTATAATTTTTCAAATTGTACTGGTCAAAGAACATGTCCAGAATGATTGTATTGATAGTGGCCTTGCTAGTGATCGCAAATCGCAGAGAA
TCTTCTGACTCTAGATGGAAATGGACACTTGCATGACTGTCAGCTTTCTTCAATATCGATCACTTTTCGGCTGACGATATGGCTTGGTACGCGGACCATT
GCTCAACATGTTGGCCCGAATGATGGAACGTGTACTTATCTATTTTGGAGGCTCCCTCCCTCCAGAGCTTGGTGCACCTATTACGAATTTACCTGCCTTC
GGCGCCGTCTTCATTCGCACGACCGATATGAACACAAAACAGTCAGGACACCGAAACAACCGCTTTGGTGTGAAAATTACGGTCTGAAATTTTAGCGTGT
AAGTAATCTTTTGTATTTAAAATAACGTGGTGCCGAGCGACTCTACCATCGATGACTGTTGCTCATCACGGTAGGCGATTCGAGAATTGCAATACAAATA
AGGGCATGGACCATTATATAATAACTCAAAGTCTTAATAGTACTCCTATTTTGTTTATTATGTTTATAATTATTCTTTATTTATTACAAAATTATGATTA
AACACGAAATTAAGGATGTCCGTAATAGTGCTCGCTTTCGCCCACAAATAAACGCGCATCCATCTATAATAAGCAATAAGGTTGTGTGATTATATACGCA
CATCTGCACACTTCTTAAATAGTTTATTGTGCAGTTAAAAACAATTCTTGATCGTGCGTTGTTTCTGGGCCCCACCGCGAGGGTTACCAAAGCTAAGCAA
AATGACGTACTTAGGCGTAACGAGTGCGGCAATGTCTTTGTAGTTACTGTGTGCATCCGAATCGAAATAATTCTTACGCTATTTCTTGTGTTCCAGACTG
GCTATAGGCGGTGCGACGAAGGACTGCTGGATATCACGGGAGGTAGAGGGGAGAATATATAAACAGTTTAAGTTAAGGGATTATTATATTGTTATGGTAT
AGAAACTTCAAACTTTCGAATATATTTGTTAAGTATGTGCGATTTATTAGTAGACTGCATGGAGATGACGTCAAAAATGACGTTGTTTGACCTACGCATG
ACAACCGCTTCCAATATCACACGTATAGCGAATCATACACTCTTGGTTAGTTGTTTTGGGTATAGAAGCTTTAATTTCAAGATCCAGATCACATGGCCAT
TGAAGGTGCACTCCGGCCAAGCAAAATAAATTATCGAAGAAGGGTGTGAAATGAAGGTACAATTATAATGGCGAAACTCTTCCAATTATTTTGCGTAGAG
AAAGAGTACGAGGAAAGAGGTGTCACAACTGGTTTGGAAAAAATTATGCGAATCTCGGGTTTGGCAGGAAGGGTGTGAGTATCAGGTTTGACAAGAAGTA
TGAATCTAAGAAAAAAGAGTGTGAATATACGAATTTGCTGCAATAAAATGGCGACGTTCGTCGGTCCTTCCCTTATCAAGCCAATATTAAAACTGAGAGA
ACAATGGATTAAATTTACTAAGCTTCGTTTAATTTGATGCACAAATTTAGTGGGTGTCCCAGTGCATCGGCATTAGAATGTTGCATATTTGCTCGATCTT
GAACTACTCCATAATCGCCGATAAAAACGCTTATAGTCGTTCAAGGTTTGCGTCATATTTGGATTTTGTTTCTCTCAAGCAAATTTTTTTTTCATTCGAG
TGAGATATAATTTTACGCTTCTATCAGTGTGCTCATAAATGAATGCACTTACTTGAGTTGTGGGGCTTTCTTGAACAGCAGATACATTACATACCATCGG
GTTAAAACACCAATACTAATGCTGTTGGCTTTCCTATCTGGTTTCTGCAAAGTCAAAGCGCAAGCAATATCTCTCCACGGAGGACTTGAAGTGACATGCT
TTGCCGTGTTCTTGATCTCCCATAATCAATATTTATGTCCACAATTTTACGCCTTCAGACTGGCCCACAAAGGTAGGCATCCTAAAAAAGTCAATATTCT
AAACTCCTGGAATATGAACATGGATTGCTTTATACTTTCTGCACGATGCACGTCTTACTCAAATCTTCTCCTATCTCTTTTCAGGCTCAACCCTATGCAG
ACCCTCTCGGGCAATATGATTTTTACGTGCCCTATTCATTGGTGCAGCATATGCTCGGTCCAAAAATACATATCTGCCAACAGAACGAACGCATTAAAAC
TCGTCTTTTTTGTTTGACCCGTAACCATTTATCACATGGCCATGCTTCTTCGTTTGACCTTAGGTTTTCAGCGTGCTTGAGAAGCACATCATAATGAATT
AGGCTTTTTGGGAAGTTATAAAATTGCAGTGCTAATCTATTCACTCAAGTAATGGTAGAGTCAACGTAAAAAACGTCAATATAGATCCAAGATCCCTTCG
GGATTTCCAGACTAAACAGCGGATGGTTTAACTCAAAATTGCTACTATTGATGGATGGTTATTGTAATAAAGCCACTGTGTTTTCACTCTGTAGACCATC
AGTCCGTAGCGCAGTGAATGTCTTTTGAAGTCCATACGATAATACAAAATATATTGAGCAATCGGTATGATGAACGTGCATTGAAGACTGAGTAATTCGG
CAAAGTATGTTTCTTTACCAGCATGATAGACATCTATGAATTCCAGATTGAAGAAGGTGCTTAAATTTTATATTTTATACAGCTGACTAAGCAATATAAG
CATCTGCGGAAATCCACGACTCGTTTTATTAGCGACTCCTGAATGAGTTGTCCTAATAAATAGATGAAAAATATTATACACACCGCCCATCAGAATATAG
CAATCGCAACCGTAAAATATGTACATCTTCGGTTGCTCTCAGTTGTGTCCAATTTCTATTGACGTAATCATTCAGCGTTTTGTGGCCCATAGCAATCGGT
CTGTCTTCATTTTAAAGATGAAGATACCGTAAGCGTCGAATCTGTTTAAAATACCATGTGCCTTATATGCATATCATCGGTATTTAGACTTTATCATATG
TGAGCTCGTACGAACCGACCATTTTTATCCTGTTCCCTCATACTTTTTAGCTTACTAATTTTTTTCATGGTGAAAAATTAATGTAAAACTAGGACCGTGA
CTTTTGCACAGCATACGGTTTTTTTTAAAGATTCACTGCTAGTATCACTCTTTACAGGTTTAACTAAACGAAGACTGTCTCTGGCATTAGTGGAGGTGAT
TTGGTGATTTTGATTCCAATAGGTACCAGCGCCATGACAGGTGGATGGGTGAATTACTGGATGAATGGGTGTGGATGATTTCTTCTGTGTAGAGATATGT
TCGTCATTCAGGTGGTGAGTCGTTAGTTGATGACACGCTCCGCGTAATAGGGCACATGAATGGGTATCATACCTTGGTAACCTCTTTATCCAAAATCAAT
CCACTGAGTCTCGTTATACAATGGGCCACTAAATCTCAGTCTGAGTGTACGCTCTTGTCGTTACCGTACCGAATAGATGATGGCAATAATAAGTGACTGA
AGGCAACCCTTAAGGTCATCCATTGCATATACTATCCTCGCTGTTTCAGACTGCCTGTTATTTCATCTTGCACTTTTTGTTATATAGCCATGCCAAGCAA
AACAATTTCGACTGGAACCCTAAGTGACATTG