Description :
From Genome Similarity Track
Location :
Scaffold_3730:632- 1964
Sequence
1332 bases(100 bases per row)
AGGATCGGCATGACAGAATCTTGATGCAGGAAGTCGCGTAACGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAG
CTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTTTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAG
GTACGGTGTTGGCTTAACCGGTGCATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCA
GGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCC
ATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTG
GGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTT
ACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATC
TGCTCTATCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGAATGGGGTGGAGCAGCAGTGAAAATCTTCACTCTGC
GTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCC
TTGCCTTTGCGTTCCTTTGCGTTGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCCCTAGGGTGTAACCGACCAAGTAGTAAATTCGGT
TAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCAATT
CCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTCACTGTGCAAATTGGAGTCTGTATTGATATT
TAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGACCCATCATC
CCAGCTGTGTTATCTTCAGATCCACCGGATAT