Description :
From Genome Similarity Track
Location :
Scaffold_5:631916- 637321
Transcript NameFunction/comments
Phyci_89746ubiquitin family protein putative
Phyci_89747Hypothetical protein
Phyci_89748DEAD/DEAH box RNA helicase putative

Sequence
5405 bases(100 bases per row)
ATGGCGAGCCACACGACGCCTCGGCAGTAGAAGCGAATGGGGCGGATGTCCGTGTCGTGCGCCGCCTTGAACCCCACACAGCCCACGTACACGCCGAAGC
AGTGCACCAGGAGCTCAATGCCGCCGATCAGCGGGTCGGGCGTGTAGTACTGCGGGTACTCGTCGTATCTGTCCACGGTTCGGTCCGTCTCGCTGGCCCC
GGTGCCTTCTCGCTCCTGCTGCGCTGCGCGTTGCTGCTGGTCGTTGGCCAGCAGCGCGAACTGGCCCATGACCTTCATGGTGTAGATGATGAGCAGGAAG
GAGCTCCAGAGCTTCACGCGCCGCGCGCAGTTGCCCAGCGGCGAGTCGAGCATGAGCGGGTCGACGCGTCGCGCCGAGTCCGACGGGAACACGGCGGACG
ACACGATGTCGCTGTTAATGTGCACGACGGTGATGCCGTCGTCGCGCGCGCCGCTCGTGCTGCCGTTGGCGTTGAGCTCGGCGTTGAGGATCTCCGGGTC
GGGCGTCGGCGCCGCGCGCACGAACAGGTGGATGGTGTGGCCGTCCTCCACCTTGTAGCTGGCCAGCGACGCCTCGTCCTCCAGCACGCGGCCGCGGTAG
ATGAGCCGCTGCGAGGCCACGGCCACGTCGGTGCTCTCCAGCACCTTCTGCTTCATCCGGGCCACGCTCCAGTCCAGCCGGCAGGCCACGTCGAAGAACT
TGCCGTTCAGGTCCAGGATGCGCACGTGGATGGCGTCCGGGTCGGCGCTGTCCGCGTCCTCGTTGGCCTGCGGCTCCGCGTCCTTCTTCTCTTCCTCTGC
GTTGGTCTCGGGGGTGGATTCCTCCTCCTTCTCCTGCTCTGCGGCGGCCACGCCGTCCTGCTGCTGCTCCAGCTCCTGGTGCTGGCGCTGCAGCGTCGGG
TGCTGCGCCTCCTCCGCCTGCGCGGCGGCGTCCGCCTCCGTCTCGCTGTCGCTGCGCATGAGCGCCGACCTGCTCGAGGCGCTGGACGGCGCCTCATTCT
CCCCCGCCGCCGCCGGCTGCTGCGCCTCCTCGTCGTCGTTGTCCGCGGGCAGCGCTGCGTATCGTCGCGCGCGGTCGCCGCTGGCCGTGGGCGACGCCCC
CAAGAACCGCCCCATACTCGCCGCTTGTCCGCAGtgaagaaactgaaccccgatacttccaccgatatacaagttagtgcgtagtgaggcaagtttccga
gtaTAAGTTCCAGTCGGTGGCAGGAGCACGAGACCCGGGTCGGGTTTGGGATGTAGCGTATTGTCCATGCACAAACCGCATTTCGGCTCGGATTTTAAAC
AGGGGCGACGAGACGGAGGGGTAGGTTTGGACGGTGATCGTGTCACACGATTCGAGTGTAGGCCCGAACGCCTGGTGTCACCGAATGACACACTCTCACC
ACGGTTTCCGCTATTGACCAGCGCTTTGTATCGGAGTCGGCGATGGCGAAGGCGAAGGCGCCCGTGGCCATGCAGTTCAAGCGGCCGGGCGGCGGCCAGG
CCGCCAAGGCCAAGCAGAAGCGCAAGGCGCGCAGAACGGTGGAGATTGTGCGGCCGTGGACAGCCCCGCAGTTCGAGGAGCTGGCCAAGGAGGACCGCGA
CATCGTGCTGGACCGGCTGCAGAAGGAGGTGGCGGCCGTGCCGCCCACGCGCAGCCACGCGGTGCTGGGCGTGAACCAAGTGGCGCGTGCCGTGGCGCGG
GGCGAGCTGCGCGTGGTGGTGTTCGCCAACAACCCCGAGTCGCTGGCGTTCGGCCACCTGCCGCTGCTCTGCCGACTGCACCAGGTGCCCGTGTGCGTGC
TGCACCTGTCGTCGAGGACGTTCGGCAGGCTGTTCCAGCTCAAGAGCGTGGTGGCCGTCGGCATCAGAGTGCCGGCGACGGGCGAGACTGCTGCTGACGG
GACCACGGGAGCTGCGGACGACGGCTCTGCGGCAGAAACTTCTGCTGTTGATGGTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACGCAACTCCAGGTTTCGTTCTTTTCTCTATCTATTTAATTTTTTAGCAGGTTGATCATTGCTTGCGAGCCTTCCT
GCTCCCCAAATTCCGTTCAAGCTGACCGTTCAACACCGAGAACGCTCGCTTCTTGTCGGCACTGGTGACCTCCTCGTCTAAATCCTCAGCCTCAGCTTCA
TCGTCATCCTTCTCACTCTCGTCCTTAGTTTTGCGGAGGATGGATGTGGCCTGAAGCTTGCCAGCCTTTTCTGCTTCAAGAGTGTCCTTGAGATGCTGAA
GAGCCTCAGTGTACCGCGGCACCAGTGTTTTCATGTGTTCCTGTTGCAGCGGGTACGGCTTCAGCTTGTTGTTGTCAGCCTTCTTGAGCATGCGCATCAT
GCCCTTCATCTGACCCATCTTCACGAGCGTCACACAGCGACCGTGGCGGCCTGCACGAGCCGTACGTCCCACACGGTGAATATACGTCTTGATGAACGAC
GGCACATCGTAGTTGACGACGTTCGCGACATCCTCGATATCCATACCACGCGCCATAGCGTCAGAACACACCACAGTCTCCACGCGTCCAGCCTTGCAGT
CCGCGACCAAGGCCGATCTCTGCTTCTGCGAAAGACTACTGGAGAACTCGCGAATGCGCTCCGGGTGAGTAGAGTACAATTGGAGCAATCTCGCAAGGCG
ATGCGTGGAGTTCACACTCGCAGTGAAGACAATTGACAGCGCGCCCGCAAACTCGCTCAGCAGCTCCAACAGCACCAGTGGCTTGGAGCCCGTGTCGCAC
TCGATCCAGTACTCGTCCAGGTTCGTCGGAGTCGAGTACATCTTGGCCGACCCGGAGGCCTCCTCTCCGTCTTCTTCGTCGTCGTTGTCCGAGTCGCCGG
CATTGCCCTGCTTGGCATTATCAGCCAGCGGGTCATCGATGCGTCCGATCTTCGTCAACTCTGCATTGCTCATGCCAATGGCCGCCAGCTTGCGCGGGTT
GCGCGTGAGCGTAGCAGACAGCAGCACTCTCGTCAGCGGCGTGCGGATGCGGCGCCTGTTGATGGAGTCCTGGCGCCGACAGGTAACGCCGACCCCCAGG
GCCAGGCCTTCCTCGTCCACCTCCTGGCCGTTGAAGACACTGGCGTAGACCTTGGGGATCCAGTCCTGGTACGACTGGTTCAGCAGTCTGTCGGCCTCGT
CGACGATCATGATCTGCAGGTGCTGCAGCGTGAAGCCCGGTGTCTGCTCCAGGTGGTCCACGAGACGGCCCGGCGTGGCCACCAGGATGTCCACCAAGCT
GCGTCCTCCACCTGTGGTCGAGGCCTGTTTGTCACCTGAAATGTCCCCCACCAGAGCGGCCTGCTCCGCCGCGAAGTTGCTCTGGCCGATGGCCAGCCCG
CACTTGAGCGGCGTGTCCTTGACGAACTGCTGCACGATCTGGTGCACCTGCACGGCCAGGTCGCGACTGGGCAGCACGACGAGCGCGCGCACGCGGCACA
CGACGCGCGGCAGCAGCCGCTGCACGATGGGCACCACGTAGGTCAGCGTCTTGCCGCTGCCCGTGGGGGCCGAGATGCAGATGTCCGTCACGCGGTCGCT
GTCGCTGGCCAGGATCTTGGGGATGGCCACGGCCTGCACGGGGAAGAAGGAGCGGATGTTCAGCGCGGCCAGCGAGCGGCCCACCTCGGGCGCCAGGCCC
CACTGCTCGGCCAGCTTGGCCACGCCGTACTTGGCCAGGAAGCGCGCCGTCGCGTCGTCCTCGCCCGCCACCATGATCGCCAATGGTTTTGTGCTGGCAC
TTGCG