Description :
From Genome Similarity Track
Location :
Scaffold_374:6316- 7322
Transcript NameFunction/comments
Aphas_H257_19311AlNc14C35G3133

Sequence
1006 bases(100 bases per row)
CAAGGTATTTAGGTGTCAAATACCCAATTTATGTACTATGTAAGGTAATAGTTCACCTTTTGTTATTTTTTAGGGCAGCATTTATCCAACACCTTCTGTT
AAAAACCCGGTATACACCCAGCGAGAGGGTAAATAAAACCACAATTAAGTACACATCCCAATTTCTATTTTTAGAATAATTGACTACCGAGCTCGGTGTC
GGAGCCATCAGACCCCGCATGATCAGCAGCAAGAGATATACCCCCAGCCAAGCACATGGACAACCTGGCCTTCCGCTTTTTCTTGTGCTTTTGACTTGCC
TTTCTCTTGTCCTTTATGAGCTTCGTACCAATGGCATTTAGTCGATTGATGTACTGGGTGTTCACATCGCCATCTTCATCCTTCAAGGGATGGAATCGGA
TGTGGACGTTGGTCAGCGCCACGCCTGTCTGGAAGATAACGTCATAGTTCTGCCGACTCCATCTGTACTTGTCCGTGCACACAGCCCACAATGTCTTCAT
TCGTCCGAAGAAGTTTTCCACCACGACCCGGTCGCTGGCGATGGCGTCATTGCGACGCTGCTCCTCGAATGTGAGGATACCGCCCTTTGGCTTCTTACTG
GGAAGCACAGCCCGAACTTCATGCTGGATGCCTTGGTAACCCTTGTCCGCAAGCACAGCCCATGAAGTGTGTTCACGGTTTGGGTCCGCAAGAAGGGTCT
CGTCCTGCTGCTTGGCGAGGCCTGCTTTGTGCACATCGACGTTCTCATCGAAGATGGTCTTGTCCGAGATACTTCCTTTGTAGTGCTCTGTGCAAAAGAT
GGCAAAGCCATTTGGGACGACCGAGATTTCGACTTTGTGACCGTAGAGCGAGTGCTTCCCACTGTAGTAATGCTTCTTCTCGGCGTACGAGCCACATGGA
GTGTTTGTTTGTTGAAACGTGACGTCGGTGGCGTATCGAGCGAACGGGAAGTTCTTGAATTGATTCCCTGATGCGATCAGGTTCTTCATGGACCACTGCT
CGGCAA