Description :
From Genome Similarity Track
Location :
Scaffold_261:6315- 10367
Sequence
4052 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGATGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TTGTTGCCATGGATAGGAACGACTTCTCCCAAATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTGTCAACACGGCCGAGCAGCTCGAGCCCGTCAATGCGTTTGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTC
CGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGA
AGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGCTGGGTGTAC
ACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGC
GTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAA
CGAACACATCAAGATGATTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACTCTTGAAGAGGCGATT
CAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCTTTGTCGGCTCCCGGCCGAACAAGCCCCA
ACGGACCAGTTCCCATGGAACTCGAATACGCTGAACAGCGTGACATCCGCGGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCTGCGAA
AAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGAAAGCTAGGAACCAGTAGGGGAGGG
GCGGGGCGCCCTACTGGGGAAGAACTAAATCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAAAGTCTTCGCACTCTCGAAT
CGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTT
GCGCACGCTGCCAGACGGTTGCTCGCAACAGCAACAAGCTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGG
GAAGGTCGTCACTGTCCCCAACGTCCAAGTGGGTCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATAT
GATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTAACGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAG
CATTGGTGAGTCATGGTCTAACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGT
ATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTGGGTCCACAGGCGGGTAACTTAGTTCCGCAG
ACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCATGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTG
AACACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGT
ACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACGCCGC
CGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGAGCCCGGGCTCTTCCGACAAGGCCGGTGGAAGAGT
GTTATCACATCTTCGATGGCGAGACTGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGA
AATGACGGCTGAGTATTTCCTGACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCC
TCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTATCAAGAACCCCAAGGATCCGGTGTATCCTT
TGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAA
GTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCG
AAATCCCCGCACTCGTCGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGG
CCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCT
GATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCG
ACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGATGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCA
AGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATAGACAAGTGCGTTTTCGCGTC
ACCAGAGATTAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGACATAGCAGCATGGCCGACGCCCCGATCCC
AGAAGGATCTTCGAAAGTGGTTGGGCTTGGTCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAA
GGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAAGCCCCTGTCCTGGCCCTGCCGGACGAGACG
AAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGT
CCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGG
CTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTC
GCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGC
GGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGTCTATATGTAAAGTTCCTCGCAGCAGGAGCGAACGTGA
AGTCCGACTGGCTCCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGT