Description :
From Genome Similarity Track
Location :
Scaffold_90:63135- 65557
Transcript NameFunction/comments
Hyaar_Emoy2808876conserved unknown protein

Sequence
2422 bases(100 bases per row)
GCAATTCTAGTCGCCTTCGGGGCAATAAAGATGAACAGTGGGAAGAACAAGTGCGCATGGAACTGCAGAAAAAACGGGCTGAGCAAGGTGATGCGAAGAT
GGTGTACTCAGTTGAGCAGCAGGCCTTATTAAAGGAGCAACAGGAAGTTCGCCAAAAGGTGCAAGAGACGCGTCGTGTTGTGTCTGCTGTGCTGGAGACC
ATTGGTATGCTAGCAGTCACTCGGCCAGATGAGCTTCACTCTACGCTACCATTCTTACTTCGCTCAGTCCGCGTATTATTCACGTGCCCACTTTTCGAGT
CTGAGGCGTCCGACGCACTGTTGGCCACAGCTAAGACTATAAGTCCGGAGCTGCTTCGCTCAAACTATCAAGACGTTGCAAGTGCCCTACGAATTGCTCT
GCAGCTCGACCGGTTTACCTCGGATAAAGCAAAGGCGGCGCACCTTGCGGAGATGCAATCGCTATATCTACGTCTGCTGGCAGAGTTGATGGAGTTCGTG
TTTGGTTTCCAGTTTGAAAGCGAGACGGACTTTGACGCCGATTCTCCGTGCAATTTGATTCCTCCGCCAACGCTGCACTTGATCTTTCCAGTGCTTTGTG
CTTCGCTGCGCTTCGCACCGGACCTGCGTCGATGGGCGCTGCCCCTTCTAGCCGTTCACGCGCGTATGATCCCTGCTGAAGAAGAAGAAGAAGTTGGTGA
TGTCGAAGCACAGCGGCTGCTTCGTGGCGATATGATGCAGCTAGTTTTGCTGCTGCTGTCCCAGCAAGCAACGGGGGATGCGTTGCCTATCACGAATCTA
GACCTGGCTCCGGGTAAACTGCTTACTTCTCTGTGTATGGGACCTGAACTCACCCCGTCGGAGTGGGCCCCTCTGCTTGGTGGGGAAGGCTTGCTTGCAG
AAGAGGCAAGTGCACGCGGTGAGGTCCTGACTGCGCTGCTCAACGTTGTTCAAAGTGATGAAGGTGGGGAGGAGTTCCGCAATGCCAAGCCCAGTTCGCT
CTTTGTCAGCCGGTTGCACTGTTGCTGCTTTGATGCGGAGGAAAAGAACCGTACTCTCGCCAAGCAGGTATGGAATGCCACAGGAGTTACGACTACGGCG
CAGTTTGCAGGTCCCCTGCTTGAATTGCTAAACCACACTCATGCTAGCGTGCGTGAAAGTGCTTCTCTAGCTCTTGCTGATGGTATGCGTCAGTTCCCGG
CGTCTGTGACGCCGCTGCTAAATGATCTGAAGACACGGTTCTTGTGCAACCAGCCAAAACCAACGAAGCAATTGGACGAGTTTGGTATTCCTATCGCTCG
CCGCTCTCATGCGCTGCCAGGGGAACATAGTGAGGATGTTCGTACAATGTACCCTCGCCTCGGTGTCGCTCTGTGCTTGGAGAAAGCTGCAGCGATTGCA
GGCCCTGAAGCAATCTCCAGCGCCAACACCATGCACCTATTGACGTTTGTTATGGAACATGGTCTCGGAGATCCGAACTCCAAGGTGCGTTCGCAGATGC
GCAAGACCGGTGTGCAAGCTGTGGCTTCGCTGGGTGGAGGCATCAATACAGTGCCACTGCTGGAAATATTTGAACGCTTTCTTGAGACGAATGCTCCTCC
TGCAGCTGCAGCGGTTGTAAAGAAAGCCAAGGTTGGGACTGAGCTTGCTGCTCAGGAAGCGAAAATGCTGGAGCAGAGAGAACAGGCGTTGTCCATCTAC
GACCATCAGCGTGAGGGTGTCGTGGTATGTTTGGGCTCTCTGGCGAAGCACATGGCCCCGACGGACCCCAAGGTGTCTTTCATCGTAGACCTGCTCCTGG
AGGCTCTTGACATTCCGTCTGAGTCGGTTCAGCGCTCGGTTGCTACGTGCCTATCGACGATTATAGGTGCAGTGAAAGAGCGCAGCACAAGTATCTTGGA
TGTCCTCATGAAGCGTGTGGCTGAAGGCCGAACTTTTGGTGAGCGCATGGGTGCAGCTTTCGGTATTTCAGCCGTGATCAAAGGACTTGGTATTTCTGCA
CTTAAGCTTCACAGCATCATCCCGCGCCTCGAAGAAGCGATGAAGACGGGCGGGGCTGATGCGCGTGAAGGCGCCATGTTTGTGTTTAAGTGTCTTAGCC
AACGCCTGGGGCTGCTGTTTGAGCCTTACATCATTGTTATCGTACCCATTATGCTCAAGTGCTCGGCCGATGCCAGTCCGCAAGTACGCACAGCTGCAAG
TCAGACTGCTAAGGGTATCATGGCCCATTTGTCGGCACATGGCGTGAAGCTGGTGTTGCCATCGCTTCTGGGTGCGCTGGAGGAGAGCGCGTGGCGTACG
AAGCAGTCCGGCATTCAGATCTTGGGCTCAATGGCGTACTGTGCCCCTCGACAGTTGGGCTCGTGTTTGCCTCAGGTGGTGCCCAAGTTGATGGCTGCGC
TGACTGACTCACACCCGAAGGT