Description :
From Genome Similarity Track
Location :
contig_8:631319- 636756
Transcript NameFunction/comments
g2059.t1ETO71634.1 hypothetical protein F444_12050 [Phytophthora parasitica P1976

Sequence
5437 bases(100 bases per row)
TTCTCAAGCATGTACAGAATCTTGTCTTCGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCGTTCTTCTTCTGCTCTAGGTCAG
GACGCTCACTTCGCACAACGTCCACCAACAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTAATGCAGATCTCAGGCAT
GTAATGCGGGTTTGCAAGCTTTGTGGTGATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGC
TTGAACACTTGCTTCAATAGCACGGGCTCCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCA
ACGTACGCAGGAAGTCCTTTTGCGATAGCTTAATGATCTGGAGTGAGTTTGATGCTTTATACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATC
GATCATAAGCGGCCAGCGGCGCCCCATGGTTGTGAATAACCCATTCTCAATTGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACA
ACGGGGTCGGCTAGCACGCGCTGGAAGGAGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGT
ATTCCGATGTAAATGGGCCAAGGTACGCGATGCAGCCTGCGGACAGGATCATGTCACCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTC
TTTCCAACGGCCTTGCTCCTCGCCCAGCGAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTC
TTCTTTTGGGCATCCTCAAGTGTTCGTTTCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTT
CGAGTCGCTGCTCGGCTGCCTTAAGGTTCTCCTTCTTTGGAGCAATGTTCTTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGA
TGTTGCAGCGGTGGAGATACTGCTCAGCGTTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCC
TTGTCGAACTCTTTGAGTTTGTCCAGAAACTTCATATCGTTAAGCAGCTTTTTGGCCTCGTTCCACTCTTGCTTTGAGCCGAATAGAAGGCACACAGCGT
TCATTGTGACACCCACAAGTCTCGGGGGATTGGTGAACGTCTTCAACACCGTAATATCATCCTTTTTCAACTGTGACAGCGCTTTGATTGACGCGTAATA
TGCGGGCATAGCTTCATCCAAGTCCTTCTGACAGTCGTCCTTGATCACCTTCACTTCGTCAGCAATCTTGTTAGCAGCCTCGACATCAGCCTGAATTAGT
TGTTGCTGTTTGTCAGCTTCTGCCTGATCCTTTGACACCTGTTCAAGCAGCAGCGATGTGTCCTTTTGAGCTTTGACTAATACCGGCTGCAACTCAGTAA
GTGAGCTCTTCAAGTTGCCTACGACTTCCTCGGTCTCCGTAAGCTTTTGCAAGCCACCGCGGTAACGTGCTTCCTTCGCACGTACGAGCTGGCGATGTGT
ACGCAGCATATCCACGTACAGTCGAATCAGCTCCAAGTAACTCGTAGGAGTGGTGTAGTTACGACGCTTTAGCTGGGCGTAAAACCGAAGAGTAGCTTCT
TCAACACTGCGGTGAATTGTCACGGCCATGCGGCACAATGTGTCCACATGTGTGTCAATACCAAGCTCCTCAGCGTTCGTAGCGAAGAAGCGGTTCGCCA
CTGAGTTAAGAGCGTCTTCTGGCCATGCATTGAACCAGTCGATGGTACAGCAATTCACGAGAGACGGAAACATGCGGCAGCGGTTCCGGAAGCCAGCGCC
GATAGGAGAAAATGCCAATACCACATGCAAATTATCACGAACAAGAGTCACGTAGTACTGGAGAATATCTTCGCGTGTAACTTTGCCCACCTGCTGAGCC
AATGGACGAACGAGACCCACAATTTTCTCCACTTCGTCGCTCGCATAAAGATTCGGCACTTCACCAGTATTAAGGACGTTGTTAATGTCTTCAAGAAAGG
ATTCATGAACGATTTGAGCATCCGAAAACAGGAAAACGACAGGCTGGTTTGAGCGCCTGCAGTCATAAGGATCTTCTTGAGGTCTTCGTGAAATTCATTG
GCGCCATATCCACGAGTAATTTCGATCGAGAAACACTTGTAATCCGCCATGAATGCAGCAAGACGTGTAAGACTCTGACGACCTGAGCCACCAACTCCAA
CGAGTAGAGCATTACCGCGAGGCTGTCGCAAAACACGGCAAATGCGCGAGATATGGTGCATGGCATCGTTGAAAAACACTAAGTGCATCTGACTCGGGAA
CGTGATGTTGTACTCTTCGAGATACTCTGACAGGAGTGAATTGAGCTGTCCGAGATCTTCAATCGGTCGGTACGTACGGTTTTCGCGCGTAAGGTAATCG
CCATACAAAATATTCTCGAAGCGCGGGAGGCCACGAAACTCGGAGCCTCTCCTCGAGTAGTTGCGAACAAGCCACATTAAACCAATCTCGATCATCAGCG
TCTACCAGACGATCACGGAAAACTCGTGCTTCTTCATGCAGCCAAAGTGTTAGCAGGCCATCTTCGTTCGGTACATTCTCCTTTTTCGCCATCAGCACAC
CCTGGAATACTTTGGAAAGATCACGAAGATTGAACGTGTAATGTGACTTCGATGGTGTAGGTAGCATCTCGAGCTCCACGCGCTGGTACAGCTGCACCGA
AGCGCTCACAATAGGTGCTGCCATGTGCGCCATTGCAGGCAACTCTGCACCGAGGAAACCGCCGAGGATTGACGAGAAGATCCGCTGCATAACCTCACCA
GAGAGATTGGGATCCAAACCATGTGGAAATGACGCATCAGACGCGGGGTCACTTCACTGCGACCACCTCCAGGAGGAGCACATGCGGCGGCAAACACCAC
ATCCTTCACATTTTTAAAGAACATTTTGGATGTGTCGTAGAAACCACCTTGGTCGATAACTTGCCGCAACAACTCGTTAGGAGGCTGCGCGCCATAGATT
TCGAGCGCCGGCATATTCAAATCATCCACAAAGAATAGCATGCGCTTTCCAACAGGTGGACCCAGCAAGTTCTTTCGCTTTTTGTCCAGCTTTAGCTCGA
ACATCTCGTTTAGGTTGCGAGGCTTGGTTTGCGCCGAGTAACTCATGGTAGATGCAATGCAGCTATCTGTCTTAGCCATATCATCCAAGAACGACTGGAC
AATAACAGATTTGCCAACACCAGTCTCGCCACTATACAGCACGTGATGATCTGAAAGCATGAGCTTCTCCAAGAGATACCGAAAGCGCGTCGTGTCTTGC
GTGGGCACCACCATCGTGAAATACGACGCTCCGGGACAAACGTGAAAGTCGGGGTCTTATCGATCCACGAGGCCCACTGACCAGTTGAGTCATCTACTAC
CACTTCGTACACATTAGTCACGGGTGTGCCGTCAGGACTGCTGTCGATCAGTGAACGGAATTGGCCCATGGAGAAGTCATTGAATTTTGGACGCGATGCG
TCGTCGATGTTTGCTCCGACAGACCACGTAACAGCGAATACAAAATACATGCGCATAAGTCCCGCTAAATTGCTAGCACCAGCGGTTTGCACAGCACCGC
TAGCGAGACAGGATGCCAGGAGATTGAGACAGCTCTGCATCAGGTTAGCATTGTTGCTGGGCACCTTTTCTCGGCAGTTTTCGCGGACAAAATCAATCGC
CACAGGAACATGAGTCTCAATCAACAAGAGAAGCATATCGCACAGCTCTGGATAGGCCGATAGAATCGGTTCCAACGTCGTCACTTTCCAGGTTCGCGCC
AAGGATGTCAATCCTACGTGCACTTGCTCCATATACACCATGCCACAACGGCTGACAGTAGCCGGCGAGGCTACACGGAGATCCTGTACCTCAAACATCA
TGTGAAGTGTGTGGGGCAGTTTGATTCGCTCACTGTTCGATAAGCACAATGTCTTGTTGTCGTCCAACACCGTATTCATGTTCTCAATCCAAACAGCATC
CACGGGTCCGTCAAAAATGACCCAGTTGCGGTTGTCAGACTCAGCGGCTTCCTGTACACACTGTCGAACCAACTTCGGTACTAGTCCATCAGTCCACTCG
TTCGTTAGGAGATTGAACTCACCATACAGCTGTCCTGCGGAGATAGATTTCGGGTTGAGGATGAGACGCTGGACCTCTTTGTAAAACCCATCGCGGTCAA
CAACACCATCTTGGTAGAGTTGAGTCAGCGCTCTCGCCAGCACGTATCCATTCGTGGTCTTTCCACTACCAGCTTCACCGACAAGCATCATACCGTGACG
GACCAACTGCGTCTCGTGAACCTGAATCGCCTTCGTGATAAATGATGGCACTTGTTGCAAGTGAAGCAGGTCCAACTGTTGCTCAATGGCTTTCTGGAGT
AGCCCATAGTCGACAAAAGGCACCACAACGCCTGGGAAGAGGTCTGCAATAATTCCGCGAAACAATGGGAGATCCTGCTCAAGGAACTTAGGTACATTAC
TGTCTCGCATAGCTCGGATGAGAAGCAGATCCTCGTGCATTTCGGGTTCCTTGCGTTTTAACTGGCCAGCAGCAACCAACACAGACTTGACGGCTCGCAT
ACCGAAATCGTAGTGATCTTGCTTTGACAATTGCTCACTGGAGAGCGAGTAAAGCTGAGTCATCTTATGCGACAGCGGCAAAGCATTCGCAAACCCCTCC
GAGAAAAGCACGATCTCGGCAATTAAACGGTAGTCCGGCACCATCATAGCAACGGGGGCGGAAAAGTGCCTTCAAGTTATCTGGAAGCTCCGTACGTCCA
GCATAACCCGGATTCATTGTAATGAAAACGCCAAAACCTGTGTTGAGTCTAATGAGATTGCCTTCAAACTCAAACTCGTCCACGTCAGCTACAATGGCCT
GTTGAATGCAAAGTACCTGCTGAGCAATCACAGACAAAACTTCGATATCAATGCGGTTGAACTCGTCGAAGCATGCCCATGCACCAGCCTGAGCGAGGCC
AGAGAAAAATCGTCCCATAATCTTGTAATCCAGTCCATCCGAGCAGTTGAAGACGACACACTGCACTGCAAGCGCTTTAGCCAAATCTTTCGTGGTTTCT
GTTTTGCCTGTACCGGCTGGTCCAGCAGGAGCGCCACCTAAACGTAGATGCAGTGCACCCGTGAGTGTCATGTAGCAAATGTCCGTCAGGGGCGTGATCA
CAAGTCTCGGTGAATTGCCAAGATATTCATATCCGTA