Description :
From Genome Similarity Track
Location :
contig_8:631312- 636749
Transcript NameFunction/comments
g1919.t1hypothetical protein

Sequence
5437 bases(100 bases per row)
TTCTCAAGCATGTACAGAATCTTGTCTTCGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCATTCTTCTTCTGCTCTAGGTCAG
GACGCTCACTTCGCACAACGTCCACCAACAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTGATGCAGATCTCAGGCAT
GTAATGCGGGTTTGCAAGCTTTGTGGTGATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGC
TTGAACACTTGCTTCAATAGCACGGGCTCCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCA
ACGTACGCAGGAAGTCCTTTTGCGATAGCTTAATGATCTGGAGTGAGTTTGATGCTTTGTACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATC
GATCATAAGCGGCCAGCGGCGCCCCATGGTTGTGAATAACCCATTCTCAATCGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACA
ACGGGGTCGGCTAGCACGCGCTGGAAGGAGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGT
ATTCCGATGTAAATGGGCCAAGGTACGCGATGCAGCCTGCGGACAGGATCATGTCGCCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTC
TTTCCAACGGCCTTGCTCCTCGCCCAGCGAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTC
TTCTTTTGGGCATCCTCAAGTGTTCGTTTCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTT
CGAGTCGCTGCTCGGCTGCCTTAAGGTTCTCCTTCTTTGGAGCAATGTTCTTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGA
TGTTGCAGCGGTGGAGATACTGCTCAGCGTTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCC
TTGTCGAACTCTTTGAGTTTGTCCAGAAACTTCATATCGTTAAGCAGCTTTTTGGCCTCATTCCACTCTTGCTTTGAGCCGAATAGAAGGCACACAGCGT
TCATTGTGACACCCACAAGTCTCGGGGGATTGGTGAACGTCTTCAACACCGTAATATCATCCTTTTTCAACTGTGACAGCGCTTTGATTGACGCGTAATA
TGCGGGCATAGCTTCATCCAAGTCCTTCTGACAGTCGTCCTTGATCACCTTCACTTCGTCAGCAATCTTGTTAGCAGCCTCGACATCAGCCTGAATTAGT
TGTTGCTGTTTGTCAGCTTCTGCCTGATCCTTTGACACCTGTTCAAGCAGCAGCGATGTGTCCTTTTGAGCTTTGACTAATACCGGCTGCAACTCAGTAA
GTGAGCTCTTCAAGTTGCCTACGACTTCCTCGGTCTCCGTAAGCTTCTGCAAGCCACCGCGGTAACGTGCTTCCTTCGCACGTACGAGCTGGCGATGTGT
ACGCAGCATATCCACGTACAGTCGAATCAGCTCCAAGTAACTCGTAGGAGTGGTGTAGTTACGACGCTTTAGCTGGGCGTAAAACCGAAGAGTAGCTTCT
TCAACACTGCGGTGAATTGTCACGGCCATGCGGCACAATGTGTCCACATGTGTGTCAATACCAAGCTCCTCAGCGTTCGTAGCGAAGAAGCGGTTCGCCA
CTGAGTTAAGAGCGTCTTCTGGCCATGCATTGAACCAGTCGATGGTACAGCAATTCACGAGAGACGGAAACATGCGGCAGCGGTTCCGGAAGCCAGCGCC
GATAGGAGAAAATGCCAATACCACATGCAAATTATCACGAACAAGAGTCACGTAGTACTGGAGAATATCTTCGCGTGTAACTTTGCCCACCTGCTGAGCC
AATGGACGAACGAGACCCACAATTTTCTCCACTTCGTCGCTCGCATAAAGATTCGGCACTTCACCAGTATTAAGGACGTTGTTAATGTCTTCAAGAAAGG
ATTCATGAACGATTTGAGCATCCGAAAACAGGAAAACGACAGGCTGGTTTGAGCGCCTGCAGTCATAAGGATCTTCTTGAGGTCTTCGTGAAATTCATTG
GCGCCATATCCACGAGTAATTTCGATCGAGAAACACTTGTAATCCGCCATGAATGCAGCAAGACGTGTAAGACTCTGACGACCTGAGCCACCAACTCCAA
CGAGTAGAGCATTACCGCGAGGCTGTCGCAAAACACGGCAAATGCGCGAGATATGGTGCATGGCATCGTTGAAAAACACCAAGTGCATCTGACTCGGGAA
CGTGATGTTGTACTCTTCGAGATACTCTGACAGCAGTGAATTGAGCTGTCCGAGATCTTCAATCGGTCGGTACGTACGGTTTTCGCGCGTAAGGTAATCG
CCATACAAAATATTCTCGAAGCGCGGGAGGCCACGAAACTCGGAGCCTCTCCTCGAGTAGTTGCGAACAAGCCACATTAAACCAATCTCGATCATCAGCG
TCTACCAGACGATCACGGAAAACTCGTGCTTCTTCATGCAGCCAAAGTGTTAGCAGGCCATCTTCGTTCGGTACATTCTCCTTTTTCGCCATCAGCACAC
CCTGGAATACTTTGGAAAGATCACGAAGATTGAACGTGTAATGTGACTTCGATGGTGTAGGTAGCATCTCGAGCTCCACGCGCTGGTACAGCTGCACCGA
AGCGCTCACAATAGGTGCTGCCATGTGTGTCATTGCAGGCAACTCTGCACCGAGGAAACCGCCGAGGATTGATGAGAAGATCCGCTGCATAACCTCACCA
GAGAGATTGGGATCCAAACCATGTGGAAATGACGCATCAGACGCGGGGTCACTTCACTGCGACCACCTCCAGGAGGAGCACATGCGGCGGCAAACACCAC
ATCCTTCACATTTTTAAAGAACATTTTGGATGTGTCGTAGAAACCACCTTGGTCGATAACTTGCCGCAACAACTCGTTAGGAGGCTGCGCGCCATAGATT
TCGAGCGCCGGCATATTCAAATCATCCACAAAGAATAGCATGCGCTTTCCAACAGGTGGACCCAGCAAGTTCTTTCGCTTTTTGTCCAGCTTTAGCTCGA
ACATCTCGTTTAGGTTGCGAGGCTTGGTTTGCGCCGAGTAACTCATGGTAGATGCAATGCAGCTATCTGTCTTAGCCATATCATCCAAGAACGACTGGAC
AATAACAGATTTGCCAACACCAGTCTCGCCACTATACAGCACGTGATGATCTGAAAGCATGAGCTTCTCCAAGAGATACCGAAAGCGCGTCGTGTCTTGC
GTGGGCACCACCATCGTGAAATACGACGCTCCGGGACAAACGTGAAAGTCGGGGTCTTATCGATCCACGAGGCCCACTGGCCAGTTGAATCATCTACTAC
CACTTCGTACACATTAGTCACGGGTGTGCCGTCAGGACTGCTGTCGATCAGTGAACGGAATTGGCCCATGGAGAAGTCATTGAATTTTGGACGCGATGCG
TCGTCGATGTTTGCTCCGACAGACCACGTAACAGCGAATACAAAATACATGCGCATAAGTCCCGCTAAATTGCTAGCACCAGCGGTTTGCACAGCACCGC
TAGCGAGACAGGATGCCAGGAGATTGAGACAGCTCTGCATCAGGTTAGCATTGTTGCTGGGCACCTTTTCTCGGCAGTTTTCGCGGACAAAATCAATCGC
CACAGGAACATGAGTCTCAATCAACAAGAGAAGCATATCGCACAGCTCTGGATAGGCCGATAGAATCGGTTCCAACGTCGTCACTTTCCAGGTTCGCGCC
AAGGATGTCAATCCTACGTGCACTTGCTCCATATACACCATGCCACAACGGCTGACAGTAGCCGGCGAGGCTACACGGAGATCCTGTACCTCAAACATCA
TGTGAAGTGTGTGGGGCAGTTTGATTCGCTCACTGTTCGATAAGCACAATGTCTTGTTGTCGTCCAACACCGTATTCATGTTCTCAATCCAAACAGCATC
CACGGGTCCGTCAAAAATGACCCAGTTGCGGTTGTCAGACTCAGCGGCTTCCTGTACACACTGTCGAACCAACTTCGGTACTAGTCCATCAGTCCACTCG
TTCGTTAGGAGATTGAACTCACCATACAGCTGTCCTGCGGAGATAGATTTCGGGTTGAGGATGAGACGCTGGACCTCTTTGTAAAACCCATCGCGGTCAA
CAACACCATCTTGGTAGAGTTGAGTCAGCGCTCTCGCCAGCACGTATCCATTCGTGGTCTTTCCACTACCAGCTTCACCGACAAGCATCATACCGTGACG
GACCAACTGCGTCTCGTGAACCTGAATCGCCTTCGTGATAAATGATGGCACTTGTTGCAAGTGAAGCAGGTCCAACTGTTGCTCAATGGCTTTCTGGAGT
AGCCCATAGTCGACAAAAGGCACCACAACGCCTGGGAAGAGGTCTGCAATAATTCCGCGAAACAATGGGAGATCCTGCTCAAGGAACTTAGGTACATTAC
TGTCTCGCATAGCTCGGATGAGAAGCAGATCCTCGTGCATTTCGGGTTCCTTGCGTTTTAACTGGCCAGCAGCAACCAACACAGACTTGACGGCTCGCAT
ACCGAAATCGTAGTGATCTTGCTTTGACAATTGCTCACTGGAGAGCGAGTAAAGCTGAGTCATCTTATGCGACAGCGGCAAAGCATTCGCAAACCCCTCC
GAGAAAAGCACGATCTCGGCAATTAAACGGTAGTCCGGCACCATCATAGCAACGGGGGCGGAAAAGTGCCTTCAAGTTATCTGGAAGCTCCGTACGTCCA
GCATAACCCGGATTCATTGTAATGAAAACGCCAAAACCTGTGTTGAGTCTAATGAGATTGCCTTCAAACTCAAACTCGTCCACGTCAGCTACAATGGCCT
GCTGAATGCAAAGTACCTGCTGAGCAATCACAGACAAAACTTCGATATCAATGCGGTTGAACTCGTCGAAGCATGCCCATGCACCAGCCTGAGCGAGGCC
AGAGAAAAATCGTCCCATAATCTTGTAATCCAGTCCATCCGAGCAGTTGAAGACGACACACTGCACTGCAAGCGCTTTAGCCAAATCTTTCGTGGTTTCT
GTTTTGCCTGTACCGGCTGGTCCAGCAGGAGCGCCACCTAAACGTAGATGCAGTGCACCCGTGAGTGTCATGTAGCAAATGTCCGTCAGGGGCGTGATCA
CAAGTCTCGGTGAATTGCCAAGATATTCATATCCGTA