Description :
From Genome Similarity Track
Location :
Scaffold_406:6313- 10680
Transcript NameFunction/comments
Hyaar_Emoy2814061type I inositol3 putative
Hyaar_Emoy2814062unnamed protein product

Sequence
4367 bases(100 bases per row)
GCGTCGTCGTGGGCTATGCGATCCCCGAGATCGTGCCTTGTGCCTTGTTTCTAGTGCTCATGTGGGAAGTCGAGCCGACGCTCGAGATCCCGTCTCGACG
GACCGTGAGCTTCCACAATGAACGAGTCATGGCGTCTGAGACGACGCCATTATTGGAACAGGAAGTCGTGCCCCGACCGCTGTTCGTGGCAGCGAAGAAC
CTCGTCCATCGAGTAGGCAGCACAGCCACGTCGACGGCCGGGTACTTGCCCGTTGGCCGACGACCGAGTCCACTGTCGCTGGGGCTAGGCATTGGCGTGC
TTGATCGGGCCAGACGACAACTGGAACTAATGGTACGTCAACATTTGGGCGGTGGCAATCGAGATCAGCAGCCAATGGACCGACAGGATTCGACAGGCAG
TGCATTTGGCTCGCCCGTCGAGTGTGACAGACATTCCAAGCAATTGGGAAATATCCCTGATGATGCGTCGATGAGGCTAGGGTCATTTACGCCCTGTGTA
TGGCTGTCGTTCCAGTGCTTTAATCTGACGCTGCCTTCAAAGCCGTCGGTAAGAGCTTCATCGTTTGTGGTGCTGCATTTGGTGCATGCTGACACAGGTG
CAGTGGTCGCGGAGATCGGACGCACTGAAATCTCGCATTCAGAAGACCCATGTTTTCATATGATGCTCGTAGTGGAAGTGCGCGCGCAGGATGTGCTCCG
GGCATCCGTTTATTCAGTTCGAGCACCTAGTTCACTTGCGGATTTGAACAGTCAGTGGCTGGTTGGCGACCCGCTTGTGCCGGTGTCGTCATTCATGATG
GACGCAGCACCCGTGATTGGACGTGCGTCTATTTTCCCACTCTACTCGCCTCTGTCACGGACTCGATCTTCGGGTGAAATCGTTGTTCGCTGCGAAGCAG
AAGTTAAAGGACTTTATGCAGGGGTGTTCTCCGGCGCCATCACTCGCTCTTTTATGTATATCGCGGTAAAAGGTACCGACGTTGATGATATCGCACCTGG
TGATGACTCGGCTTATTCCGAGATAGCTCAGCAGATGATTGATCTTGCGTCCACATCTCAACGCGCTCAGGGCAAGATGTTGGTCGAAGAAGAGTTGATT
GAAAGTGTGTATACTTGGGAGGTACCTTATCAACTTCTCCAGTTGATACTGTCCGATTTGCTGGTGAAACTTGATTTACTAAAGCGTGAAATTGCGCTTG
AGGATGGCGATGAGAGTGCTCCGTCCACTCCGTCTAGCCAGCTTTCGACCCCGACTGTTGGCAACTATTCACTGCCGTTGGTTATCCCTACTTCCCCCAG
GGCACTTGGTGCGGTGCAAGAAAACGAAACCGATCATGCGACGCAAGTGTGGGAAAATGTGGGGTCTTTCCAATCGGTTGCTTGTGGATTAAGCTCTTCA
TCTGCACTAGAAAATCGGACGAGGCCAGCAAACAGCATCGGAATGCTCTCTGAAATGATCATACAAATTCAAGACGATGTTATTGAACGGAAAAAACGGA
AATGGCGGCTGGAGCTTGTCAAAACTATGGAGCAATATATCTCGGAGGTGGAGGACTCGATCTTGCGGTACGGAGCCACTCAACATGCCGGACTCACCTT
TAAGCCAAGCACGATGAAGGCAGACGCAGACCTACGTTTTCTGGCATTAAACCTTCACCAACAATTGATGACGGTGGGCAATGCAGCCCCGACGTCAGAA
AAAGACGTACACTTTGGGGACCAAACAAGCGCAGCGCGCTACGCTCATCTTGTGAACTCATTTGTCGGGACGCTCGTGTCGTCTCCTTCGCACATGTCGA
GGCAATCGAGCATGCATGGACAAGAGAATTATCTCGATTCTGTGAAATTCATTGACGACGACGAAAATGGTACAGAAGATATCGCCTCGCCTTACTTGAT
CGAGGAATCACCACTCGAACCCGTTGATGCGCTCCGTCGGCGTGTAATTTCGTTCGATTCGGCGGCAACAATCGTGAACAAGGGAGTCACAGACCAAGAT
TTTGCAGTCACTTCCGAACAACGGAAGCTAGCCGAAACCATTGTAGCAATGGGAATCACTGAAGAAGAGTTTCAGAACATGTACGGAGGGGACAGAAAGA
TTGACGCATCCGATGCAATTGACATTGTAGCCGACATAATGGTTGGCCGCTTGGATGATGGATTGAAGCTTGCAGTACCGAGCAGTGAATGCTGCTCATT
GCCACAAGTTCCAAAGTTGGACTTGGAGCAGGCTAAAGTGCCGATTATAAGTAGTACAAACGCTAGTGGTAATGCTCCATTTTACAAGCATCGAATGTAT
GGTACAACGACGGTAGGAGCTTTTGCAGCGCATGTGTACGGGTTTAAGAGCGGTGGCGTGCGCCAGATGCGCGAAGAATTGGAGCGACTTCATGGACGTT
TAGTGAAGGCAGCGCAGGAGAGTTCTGATCTTACAATGGACGCGTTGGAGCGCAAATACAACGAGCTGAAGTGGGATGTTGAGCGTCGACTCGAGGTGGC
GTTTTGTCAGGCGATGAGTGCTCTAGTCACGTGTTTTCAGCAAACCCTTTACGTCCACACACACGATCACGGGGATTTTGGTCCCAATCCACTAAAAGCT
TGCTGCGGTATTGACTACCTCGAAATGCTTACGAGGGTCGGCTTTTTGTTCTCTGTGGAGAGTTTGCTGTCAACGTACGGTAACGAGCTCGGAATGCTGG
GTGATACTGAGACAGCTGTCAAGGAGCTGGGGAGAGTCCACATTAAGCTACGACCAGTGAAGTCTCCGCGTGCAGCGGCGTTCCGTGTATCCATTACTTC
AGGACCATCAGGCATCGCGATCGAGCTTCCGATCATTACACGTCGTGCAAGTGAGTTCCCTGAGCGAAGCATGCACCGAGTCCCAGGACAAGATGCAGTA
TCGGGGGCTATTTATTTGCCGCTCTCAACCCCAGAGGAAAAAATGCGCGCAAAGTTTTTGTTTCAGAAGCCCATTCGAGTCGTACCAGTGATCTTCTCGC
AGGGAATGAATGAAATGCAGACGGTTGCAAACACTGTGGGCAAGGACTCGTTGCAGAAAGAGATTAATGCTGAGAATGTGGTCGAGTTGGAGGCGTACAT
CAATGAATTTGCTAGCTGGGTCTCCAAGAAACAGATGCGCGATCAAACATCGACTCCGATATACGACACTGAAGACCTTGGTCGAATTCAGACGTCACTG
ACAGCTCTCAAGACATGTATTCAACTATCAGGCCGGTCGAAGCGCATGGCGATCCTGAGTTTGTCGTCATCAATTGCTCGTTCTGTTGGTGGCGGCCGCG
TGACGATGTGTAAGTCGGCCAAGGATCGTACGTCAATGTCGATCACGCTTGAAGAAGCGAACCTTTTGGTTCGCTCACACGGTCTTGTTGCGGACGAGGT
GGAAGTATTTACGAACTTGCTCCGGACACACGGAGTTCGTCGTGAGAATGCGAGAAAGAACATCGGTAAAGCGCAGTATTGCTTCAGTGCGCTGCAAAAC
TACATGCTGCCGCAGGATTATCAGTGTCCGCCAGGCACTGGGGGCGGTAGTCGAGCGTATTCGTAGAAAAGGACGGTGAGCATGGCATATTAAAACCAAG
TTGTTAGTGAACTGCAATCTTTTTGTGGTTTACGAGACCCCTACACAAGTACTAGAGGTTGCGGACGTCACGTGTTCAGGAGCACGTCAGGATGTCCTGC
ATTGACATTGTACGAGGGTTAAGCTGCTGCTGCCAAAGGGTGCTACCCTGGTTCATGGGCCGCATTAATATCTGACCCTTATAGCCACTGAGGATGGACG
CGTCAACGAGCAAGTTCAAGGGTGGCATAGGTGACGGCTCCTGCCTGGAAACAGTGTCAGCTTGCGTGCAAATACTTGGCGCTATCCATTGAGTATTCCT
TGAACACGGACTCACAGTTGAGACGGCGATGCCTGGCTTTTTGCCAATACTGGGACGCTGCGGGTCGAGAATGAAGCCGTGTACTATCGCTGGTGGTGTC
AACGACGGTGCTGTAGACGTAATAGGATTGAAGGAGCTTGATGTAGCTTGCGGAGGCATCCGTACTTTGGTCGTATAATCGCTACCACCGGACCCAGACA
TGCGTTCATCACCATTATCAGAAACGTTTGTGGTGGTAGTCGAGAGTGTTGGAGAACAGCACCAGGAACTTGTGCCCACAACGCGCATCTTGGATGGTGC
TGCTTCTTCCAGTGGCAGAAGGTCTCGCTGAGGTATCTTCACTCGTAGCAGACGTTTGGCGCTGGCGTTGCGAAGAAGACTGGGGGCGTCGGGGTGAAGC
TCTGTCGTGGTCAATGACTCACGTTCTTTTTCGAGCTTGCGTCGTAGGTTTCCTATAGCCTCTTGAC