Description :
From Genome Similarity Track
Location :
Scaffold_1163:6313- 7392
Transcript NameFunction/comments
g7440.t1hypothetical protein

Sequence
1079 bases(100 bases per row)
CTTCGAGAGACTTCAACAACAGACCCTCAAGGTCGTACAGCTGTACGCTTCAACGTATTTGTAGCGCGGCCCCCACCCGTCCAGCGTGTTTGGTGGCACA
GGCCGCTGGACGAGGTCGGGCGTGGTGGCGACGGCGGCAGTGACATCGGCCAGCGGCCGGTGTGCCGCGCGGCTTCGAAGGTGGCGGGCGTGTACCTCGT
TGTGCACATGCAGATGCGACCGTTGGCGACCGTTGGCGATGGGTTGGCGACCGTTGGCGATGGGCTGGCGTATTCGTTCGGCCGGCAGCGTGTTTGGTGG
CGACGGCGGCAGCGACATCGGCCAGCGGCCGGCGTGCCGCGCGGCTTCGAAGGTGGCGGGCGTGTACCTCGTTGTGCACATGCAGATGCGACCGTTGGCG
ACCGTTGGCGATGGGTTGGCGACCGTTGGCGATGGGCTGGCGTATTCGTTCGGCCGGCAGCGTGTTTGGTGGCACAGGCCACTGGACGAGGTCGGGCGTG
GTGGCGACGGCGGCAGTGACATCGGCCAGCGGCCGGCGTGCCGCGCGGCTTCGAAGGTGGCGGGCGTGTACCTCGTTGTGCACATGCAGATGCGACCGTT
GGCGACCGTTGGCGATGGGTTGGCGATGGGCTGGCGTATTCGTTCGGCCGGCAGCGTGTTTGGTGGCACAGGCCACTGGACGAGGTCGGGCGTGGTGGCG
ACGGCGGCAGTGACATCGGCCAGCGGCCGGCGTGCCGCGCGGCTTCGAAGGTGGCGGGCGTGTACCTCGTTGTGCACATGCACATGCACATGCGACCGTT
GCCGATGGTTGACGACCATTGGCGACTGTTGGCGACCGTTGGCGACCGTTTCCGATGGGCTGGCGTATTCGTCCGGCCGGCAGCGTGTTTGGTGGCACAG
GCCGCTGGATGAGGTCGGGCGTGGTGGCGACGGCGGCAGTGACATCGGCCAGCGGCCGGCGTGCCGCGCGGCTTCGACGGCGGCGGGCGTGTACCTCGTT
CTGCACATGCAGATGCGACCTTGCGGATGGTTGGCGAATGGGCTGGCGTATTTCGTTCGGCCGGCAGCGGTGTTTGGTG