Description :
From Genome Similarity Track
Location :
contig_24:631251- 633535
Transcript NameFunction/comments
g5774.t1ETL94500.1 hypothetical protein L917_07560 [Phytophthora parasitica
g5775.t1POM58505.1 Iron(III)-zinc(II) purple acid phosphatase [Phytophthora palmivora var. palmivora

Sequence
2284 bases(100 bases per row)
AGGCATCAAATACGTACTTGGAAGTCAATAGGAAGGTCAATACCAGGAGACTTGGCTCCCATCGAAAGCGCGCGAGCAGTCTCGAGAGCCGCTCTGTCCT
CCTCGGACAGCCCGTCCATAGCGTCATCCTCATCAGCCTCTTCCTTCGTCTCTTCGACGTCCTCCTTCTTCTCACCTGCAGGTTTCTGCTAAGTGAAAGC
GGTACATCAAGCAAGAACGTAATGAGCGTGAGTTCTCCTTTCTCAATTACACCGCACTGTGATACCGCGTACGTACGTCCTTGAACTCGTTCAAAATCTT
TCGGCATTCCTGTCACGGGAGATCTTCATGGTTGCCTGTAGCTCGTCAGAGCAGAAGTCGAAGACATCCAGTGTCGTGGGGAAACTGATAGGCTGCAGAA
CCAAACGTGTTCCGTCAATGGACGTGCCTAACAAGCGCAAGGAAATACTTTCTTTACCCGCAGCATTTTGCACTTGACACCGGTGTGGTCGCGGCTCTCC
GGCGTCGCCTTCCAGTAGAAGCGCATAAACTGTACGCACAGTACTTGGGCAGGCGTTTATCCGAAGCGTTTTCTTCCACACCGCGTTGCGATCCAGCACA
TCCGAGTGCTTCTCAATCGTTCCTTCCAGTCCCTATTCACCAATCACATCTTCAATAAGACACCCAATCTCCATCCCAACCCAAATCAAAGCAACAATCA
TAAAACTTACAATCTTGATGCCTTCGGACAGGTGGTTGGTCTCAATGGTGATGTTGCACACGAGCTTGAGCGCCTTCTCCTTCTTCAAGACGGGGGTCTC
CATCTCGCTCTCCGTGCACTCAATTTTCTCATTCAACTCCAACCCAAACAACGCGTCCACGACGTTGCTCGTGGGTCCGAGAGTCTTTAGTGCCCCCGCG
GGTTGCGTCAGCGTCTGCTGCAGCGTCGCAAAGAGCGTGGACAGGAACTCCTCGCTGTCCTGCTGCATGTACCCGCCACTCCTGGGCGACTGCTGCGCGA
ACTGCGGGTACGCGCGACGCAGCACGGACACGAACATGGAGGGGGTGATGCTGTCCACGCTGCCATCCAGCTGTGTGTACATGTCCTTGAGTGCAGTAGT
AAAGTTGTTGGCCAGGTCAGCAGACACGCCACCCGCCTGGGCCTTGAAAGCCTCGCGCAGCTCCTTCACGGGCCGCAAACACTGGAGCGTGGCGTTCATG
TAGCACGTATTGCCGAGGTTCACGAGGCCTGCGGGATACACTGTGCCAGTAGCTGCGATATCCTTGGTGGTCATGTCCTCAATGAAGATGATGGGCTCCT
TGGGCTTGTTCACCACCTCGGCCGATCCCATGAGCATGACACCTGTGCCGTCCACGAGCTTGTCGAGCGTCGAGAGGTCCACGTCGTCCTTGAGCATCCC
CTTCCAGGCCTTGGACATGAGCTTCTGGCGCTCCACAGGCACGGACGTGAGCGCGTACAGCTGCGCCTTGAGCACGGCCACGGGAGCTGACTTGTCCACC
GCCACGTCCTTGAACACCTGCTTTCCCCATTTGACACTCACCTGGGCCGTCATGACTAGCGTTGATCCTTGGAGCTCTTGTTGGACTGTGGGGGGATTGA
AGATCGCGACCTCGAGAAGCTTCATTTGATTGGCAGAAAACATATTATACGGCTGATGATTGGTGGAATGTGATTACGAAATCAATGTCGAATTTTGGAA
ATTGGATTCGTAGAGATTCGCACATGGCTACATGCATGCACTGCTTATAGATCTTAGGATACTTTCTTCTTCGCTTAACGTTTTGGCACCTCTCATCCCG
CTCGGTACTTGGATGTCGTCAAGGCGACCGTATCACGCAGAATGGCGTCGCCCGTCGCCTGGTCTTCGAACCACTGCATGCTCGCGTGAGTGCGGTTGGC
CACATTCAGTAGCGAGAAGCCGTAGTCAGCTTGCCGGAAGGCTGACCACTCCGGCTGCGGGTCGAAATACGTCGGTGCCAGGCCTTCGCGGTTGCCGGCA
TCGCCTAGCACAACGTACACGGGGGCGTCTTCAACGACCTTCTGCTTGTACACTGGGTGACTGCGCTCGTAAGCGTGGACGTGTCCGGAGACGACGACAT
CCACCTTGTTCCGGTAGAGAATATCCTCCATGTTCTTCTTCATGATCATGTGTGGCTCCATGCCCTGGTGCGCCGTGTTGCTGTTGTACCACGGCCCGTG
CATGATTACCACCAACCACGGGGTGACGCTGCGGTCGACGCGCTGGAACTCTTGCTGCACCCACTCGTACTGCAGCGAATCGGG