Description :
From Genome Similarity Track
Location :
Scaffold_26:63124- 64586
Transcript NameFunction/comments
Physo_133411hypothetical protein

Sequence
1462 bases(100 bases per row)
CCGTCAAGATTAATGCTGTTCGTTTCAACCAGCAGCACAACGCGGAGCCTCTAGGAAGCACTCGGCAAGACCAGGCGCTTCAACCGACCTTGTCCCAGCG
CAGTGTGCCCCCGACACCGATGAAGAAGACCCCTCGACTGCGAGAAGACACCGTGAATAGTAACAACTCGGTGCCGCGTAGTCGAGGTGAGAGCAGTGTC
GTACTAGGCCAGCAGTATGTGTGTGACGTTCCGGGGTGCACGTGTGGCATCCCGCGCGACGTATTCCTCCGCATTGGTGCTGCGCTGAACGACGAGTAAG
TCAAATTATGGGGAGGGGCATGGGGTATTACGAAAAATAGTTGAGTTGAGGTTAACGAAGCAAAAATAGGGGTAATGTTGGAAAAGGTTAGGGGGTGTCG
CAGAATAATGTTAAATTTGAAATTCATACCCCCTTCTGTGCACAATGACATTACCTGTGCTTGCTACGATGGAGGCGGTGGATTGCCGCCGCTTCCTCGC
GGCCTGGACGCGATTCCAAGCCAACAAGGAGTACCCTCTAGATGCCGACATCATAGACCAGGTACCCACACATCTTACCACGTTTCCACTCTCTCCTCTC
CGCCTATAACACTCACAACTCTCGTGCTTACGTGTCCAAACAGTATCAGCACTTGGCGCTGCACTTCCAGCAGCTCAGCCAGAACAGCGACGGCTTGAAG
GCCCTGGGGCCGGAGTTTGCCCCCGTGATGGACGCCATCGCCACACTTAAGAGAGAGCTGGAGGTGGACAATGTCAAACCCATGCGGATTCCACGAGCTG
CCGAGGTCGCCAAGATGAGGGAGGAACGCGCTCGTGCTGCTGCCAAGGTGCAGACTGAACCCGAGGATCCTGTGGATGGCCAAGAGAGGCAGTCGGCGCT
CAGTGAGGAGGTAAAGGAGGCGGTGGTGGATTCAACGCCGGAGCTGCGCTCAGACCTGACGGCGGACGACTTCAAGGCGATGCTCGAGGTGGCCACCCCA
CAGGAGGAGAAGCTGTCCACCAAGGCCATCAGGAAGAGACTGGGCCTTGTGGATCGCGCTGGGGCGCAGGCAAGTGCGTCCGAGACCGTGGCGCGTGAAG
AGCAGGAGTCGATTCAGTCGGAGATGATGTCGCTGGCCAAGCAACTCAAGGACCGGACGCAGACGATCAACCAGTCGCTGGCTGAAGATGTGAAGATCCT
GGACGCCGTGGGGCAGAGCGCCGAGTCGAACACGGCTCTGCTTGACCGTGAGAACGCCAAGCTAAAGGAGCAACTGGCGTCCAGTATTGGCTTCTGGACA
TCGCTGTGGCTGGTGGCCATGCTGATTATCGTGTTTATCGTCACGTATTTTTACATGAAGCTCTTCTCGCGGAGATGGTAGAGCTGTCGGAAGAGTTAAC
TGGAGAGCGATCGGCTAAGGTTAACACGAAATACAGTGTATTGGCTCTATTCGATGCTTCAC