Description :
From Genome Similarity Track
Location :
Scaffold_82:63114- 65772
Sequence
2658 bases(100 bases per row)
AGTCGTTGAGCGTATCCGGCACTGCCTGTGCGCAAACCTGACAAAGAGAATGAGTGGAGGCAGACGATTTACTTTCGACCGGTGAATGCTCTCACACAAC
CACTTGCAGGTGGCATGACGAACAACAACATGCATCTGAACGGTGTAAGGGATAAGGAGCACAAACAAACTGCAGACTTCATCAAGAGCTTCTTCCAAAT
GGCTCTTGCAGCTGACCGTGAAGAGGGCCCGTCGTACATGGCAGCTGATGGCGAAGTCGTTACGCCGACTCGCCTGTAGCAAGGCTCCGTGGGCTCTTCC
CTGCACTTTTAGCAGTCGATCTAAAAATTGATGCGCGAGAAGAACCTTTTGTTTGAGCAGCTCATTTACGCAAGGACAATTGATGGATTTCCCGAGATTG
TTGATATAATTTACGCGCAGTTGGAGAAGTATGGTCTGTTTCTACGCATGGACAAGATCTGTTTGTACAACAGAACCGCGAAGTGGTGTGGCCGCGTGCT
GACCAAGGACGGTGTGGCGTATGATTCGAGTAACATCCAAGCTCTCATTGACATGCCCGTGCTCGCCACCGCTGGAGCACTACAGCAATCCTGTGTGCTG
CGGACTGGATACGTAGCAGTCTAGTCGACTTTGCTCGGGTCTGACAGCCTCTACAGGCGCGGCTGGACAAGGAGCTGGCTGGCACTCGCCGCACCAAGCG
AGTGGCTAGCAACATCTCCATTGAGTTGACTCCAGATGAGATGTAGAGCTTCAATAACGTGAAGAAGCTACTTCAGAATGCTGCAACGCTTGCATCACCA
GATCCAGCAGGCACTATCTGCAGGTACGGTGATGCGAGCGACGAAGGCTGGAGCATCCTTTTATCGCAAATGAGGGACCGGGACAATCGCGCACCAGTCA
GCGACCAGCACCTAATCTCTTACACTGCATGAGCGGGATTTTTCATGGCGCCTCTAAGAATTGGAGCGTCATCGACAAGGAGGGATACCCGATTGTGCAC
GCATGCTCCGAGCTGGACTACCTGCTCATCAGAGACAAGGGATTCAACATGTTCACTGACCATCGGAACCTCATCTATATTTTCGCTCCTGGCACGGAAA
TCAAGAATCACATTCGTGACAAGCTTCTCTGGTGGAGTTTGAACTTCAGTGAGTACAACTATTTAATTGAGCACATTGCTGATGAGGACAATGTCTGGGC
TGACATGTTCTCCAGGTGGGCTGGTAAAAAATCGGCTACAGCTCGAACCTGCTCGAGGAATACTGCGACGTCGTCTCAGCTTCGCCCCCTGGTTGATTAG
TAATGGCCAAGCATCGATGGCATTCGTGACGCTCAACGGGGCAAAGTGGCGCCCACCTCTCATCACTTGGACGACCAAGATGTGTACGTTGACTCCAGTT
CCAGGCCGTGGACTCAGAGGAAGCTGAGGATCCCCCTTTCCGCCTCATGATTGTGGCTCACTGTGGGACCCAAGGGCATCGTGGGGTGAATGCAATGGTG
CAGCAACTGGGGCGATTCTTTGACATCACTAGCGTGCACATCAATGCAAGAGCGTTTTGCGTAGACTGCCTACTGTGTTGCCATGCGAAGGGAGGCAACA
TCGTCCCCAGACAGTACGGCGAGTTTTTCTGATCTGAGGAGCGAAATGAAAATATGCACATGGATTTTCTTTACGTTGGGAGCTACGACGACACTAGCGA
CTACATTTTAGTGCTGAAGGACGACTACTCTCGCTTCTGCGAACTAGTGGTATGCAAGCAAGCCGACGCAGCAACAGCAGCCCATGACATTCTGGAGTGG
AACATGCGATTGGGCCACCACAAATACCGATCAGCGATACGACAGCCCACTTCAAGAACGAGTTGATGAGTTCATGCAGGGTCGTCAAGGATTTTCTGTT
GCATACTGCCCATGTGATGATACTAGAATTTCGACGACGACAACAGCAGTGAGTCGACCTTCTCCCACTTGTTCAAGCGAACCTCAACCAGACACCAGTG
CCATCGCTTGCAGACTTTTCACCCATTGAAGTGTTCACGGGGCTCGAGTGTCCGTATCCGCTCAAGAGCATTGTCGTGCAGACAACCAAGGGTAGCAAGC
AAGAGGTGAGCGTTGAGGCTATGCCGGACAGCATTACGACAAAAGTGCAATCGCTCCGCCAACATCTGCGCTGCATGCATCAGCGTTGGAGGAGGCCAAA
AGCACACAAACACGCCGCAACAAACGTAGCCAGCGCAACGCCACGTCGGTCAACTTTCACATTGGGGGTTTTGTACTCCCGTGGAGCACCAACTGACTGG
TGTCACGCGTCACGTGCACGCCTCTCGCTTGAAGTTTCATGTTGAGAGCTCATTTGATGTGACGGAATAAGTGACAGAACACATTGTCAATCAAGATGTG
TATCTGACGGGGCGAAACTTTGTCGAGCACCGCTCCAGTATAGAGCATGACTACGAACTGCTTGTCGCGTTAGAAGGTCTCGAGGACATCGAAAACTCGT
TGGAGCCCATCGGCAAATGCCACAAGGACATGCGAATCAAGCTACAGCACTACATCGATCAGGCGGGGGATGGTAACCTCACCGCATTCGCGCTGACCCT
CTTACCCAGCAACAGCAACCCGCATAAGGTAGCAATGCCTACGAAGCCAGTGCAGCCA