Description :
From Genome Similarity Track
Location :
Scaffold_1149:6311- 8559
Transcript NameFunction/comments
Phypl_g12565hypothetical protein

Sequence
2248 bases(100 bases per row)
AATCCTGGGGAATGACACTTTCGTCGGCATCAGTGTCGGGAGAGTACGGCACTTCTAGCAGACCATTGAGGCGGACGGTCGCATCAGGTACCGCATACCG
CGCAGCCTTCGAGCGCAGTGAACCAGTGCGCTGTTCCTTAGCCTTGCGGAAGCGCTTCCTCGCTTCCTCGCGCTGTGCGTCCGTGGCCGTCGGGCAATCC
TTGAGCCAGTGGGCTCCCTTGCAGACCAAGCAGCCATCATGAGGCGGAAGACGTGAAggccgcgccgccgacgcACCGCTTGTCCTCggcagtgctgcag
ctggcggcgccgggcgtggcgtcgtcgactTGTCACTCGTGGCGCGCTGCGGCTTGCGATCTGACTTCAGCGACTTGATTTCCGCTTTTGCAGAATAGTC
CTGCGACATACGATGAAACCGTTGCTGCACCTTCGCATGCTCCAATATCAAATCAAAGAGGGCAACATCATCAGATTTGCAGTCACGCCTCTCTAATTCG
ATAAGCCGCATAATCTGAGCCTTGAGGACTGGCGGCTGTAGGTTTTCCACCAGTAGACGACAGCGAGACTTCATCCGACTCTTGTAGCCAGCTTCTGCCT
CGCTCCCAGTTCCGATCAGTATTTGCAGGCCATTGTCCTCCACGAGGCCATTGAAGTCTTCGTAGTAGCGAAAGATCCGGGCATCACAGTCATCAATTGA
TAGGTCCATCTTAAGTTGCTGGCGGAACAGAGACCTGACATCTGGCACAAACTcgttcttgagcgtgcgGCATCGTGTCTGCACGGCACCCATGATGTCA
GCGTCGGTCACAGAGGCCAAaggcttcttgagcacgtaGGTAGCCATGTTCTTCAGTGTCTTTGGCTTGACTAACCCTCTTACAGTAGCCACGACGTTCT
CGAACATGTACAGCGATGACGGATCTTGTCCACGTAGCGTTCCCACTCACGGTGCCACTCAATCAGTGCTGCATGCTCCCAGCTGGACAGCTCAGGGGCC
CGGATCACCTCGAAGATCTGCTGAGGGATCGACATCTCCACATCGCCGTCGGAGTCCACCGCGAAGCACGGCATTGCTGAAGTTCTCTTCAACCGAACCT
AAGGCGAACTTAACAGAACCGCACTTAGGGAGTACCGAACTTTTGCAAATTCGTACTTGATCGACGTGACCCGGTAGTCTCGagcccagcgacgacagGG
AACTTTCGGTCGGCATGCGCACCGAAGAGATCAACAAACTCACGCTTCGAAGAGCGCAAAGCACGCTTTGTCGCGAATTGCCGGGGGGTTGTTTCCAAAA
CGGAAAGTTTATTAATGACAAAAAACAAAGATCAAATGCTGAGCGGCTACAAGACGACTACAGTGCTCTCTCCTAGCGTTCTCCCTATGCATCTCCACCG
TACCGCTGTTCATGTAGTTGCAGGCGCGTGCCCGCGCCCACTGCCCACTCGCGCCGCGTGCCACGAGTGGCTTAATCTCCAAGGCTTGTGctgcgtctcc
ttctcgtagGCCTCGAGGCACGCAGCAGTCACGGCCATTGGCCAGGCACCTCGGCGTACGGAGGTCGAAGCTCCGCTGCATCTCGGGCTTGACCGTAATC
AGGCGACAAAGTAATATCATCCCGACGCGCTGCGTACCGGTCTGTGGGGTGAGTATCTGTTCTGGCAGTCTGGAACTCATCAAACACGATGGCATCGCGC
TTGACGGACTCCAACTCTGCCTGAAGCTCGCTTATGGTCGCTGTGCGAGCGGTGTCACGATCGTCCAATCGGATAATCTTTTTCTGCATCTATGCTCTGT
CTTGGTGACAGAGCACGTCGCATCGCGCCAGTTCCCCTTCACACTCTTCTTGGGTCATTTATCCTTTGCCAGCGTCTAGAAGTCGCTGCCCCCTTAGTGC
ATCCTTCATTCGCGTGTGAGCGGCTTCTCAAGCTCTCTCAATTGTTTTGCATGACCCTTGAATGTGCTGAAGTGCCGACTTCGAGCCACCTGCTTGTACG
CAACAGCTGTACCACAGTTTCTGGCCGCTCTGTACAAAATCGCCATGATGTTCTTTTGCGAAGCGGAGAGCTTGAACGACTCGCACTTTAGGTGGCGCCC
GTATTGGCGTTGGCCATGCTTGTCTCGATGTAGCTTGCTCTTCAGTTCTCGGCACGCTTCTGGTAGCTCCGCCAGTGAGAGCTCGATGTCGGTGGGGCCT
TTGTTGGTTGTGACCCCTTTGACTATATGTTTGTGGGGCTACGCTAAG