Description :
From Genome Similarity Track
Location :
Scaffold_41:6311- 8531
Transcript NameFunction/comments
Physo_135810pol protein

Sequence
2220 bases(100 bases per row)
CTTGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTGTTCGGCTCTCAGCCGTTCGTGATTTACACGGATCATACGTCGTTACGCACCGCGACTC
AGTCGCCTCATCTCTCGCAAAGGATGGCCCGTTAGCTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCTTGC
GGACGCTCTCTCGCACAGGCCGGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTACCGGATTTGATCCGAACGGCTTATGCCAAGGACGAC
GCCTGTGTCGCGTTGCTGAAGGCTCTGGGGAGCAAGGAGTTTCAAGACTCGGACATGGAATTGTCAGCGCGGTTGCGCGCGCGGCTACACCGATATTCCC
TCGATGGTGGCCTGTTGTTCTACAACACGGGCCCCGATGATACGCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTACCGCATCCTCTATGAGGG
ACACGACACGCCGCTGGCCGGCCATCTTGGCCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGCTGTACAAGTGGACGAGCACTTATGTGCGCAC
GTGCGAGACGTGTCAGCGAGTGAAGTCGTCACCTCATGCTGCAGCGCCGTTGGCGAGTTTGCCTGTCCCTTCGGGCTGTTGGCAATCCATGAGTATGGAC
TTTGTGTTTGGCCTGCCGGCGGACGCGGCGGGCAGCACTGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATA
CCATCGATGGTAAAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTTCCTGAGTCGATTGTCTCGGACCGAGACTCCCGCTTCAC
GGGCAACTTCTGGAGCGCGGTCTTTGCTGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACAGAGCGCGTGAAT
CGCGTCGTCGAGGACGTGCTCCGCAGCATTTGCGCTGAGACACCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGC
ACGCCTCGACAGGCTACACACCGTTCTACGTGAACAGCCTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGGGGCCTCGGGCTTGGTGGGGGAGG
AGAAGCCGATTTAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCTTACGACAT
GCGCGTGACGCAATGGCTGAAAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGAGGCAGAAGCAATGTTGAAAGTTATGAGGTCGGGGACCTGGTGC
TGCTTAACGCTAAGAACCTACACATGCAGTGTCATCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGC
CTTGCGTACACGCTCAATCTTCCGAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAGGACCCGATGCAGGTGCAGATGGAGGC
ACCGAGGGTGACGAGGTCACAGGCGCGGAGGTCGCGGTCGTCGAGGACGCAGGACGCGGCCATCAACGCGGGCACCGCAGGCACAGGCGGGAGTGCCGCG
GGCACAGCGAGAGCCGCAGGTGCAGGAGGCGCAGAAGTCGGAGAGTGCATGCGGGCCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCAGACGCTATA
GCTCCCCGAGCTGCCGGTCACGCTGCTCATCGCGATCGCGATTTTATCGCACCCAGCCCTCCAGGGCCTCAAGGCGGTCCCAGACCTCTCGAGGCACCTC
GATCCGTCCGTCTCTGCGAGCTGGTCGAGTTCAGTGGCAGTCCGGCCCAGACGCGCATCAACGTCATGGATGTGATCCCGAAGGCGGCCCGCCTGCTGCT
GCGCCTCTAAGATCTCATCTTGAGTCGCAGGGGCCCCACCGCGGCCTCCACCAGCTCTGCTCAATGAGGATGGGAATCTGCATTACCATGTGGAGCGCCT
CCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGC
CAAGACTGCCCAGACGTCGT