Description :
From Genome Similarity Track
Location :
contig_10:63104- 65443
Transcript NameFunction/comments
g3259.t1hypothetical protein

Sequence
2339 bases(100 bases per row)
GGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCTGCCATCGGCAAGCAGT
CGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGT
CGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCA
TGGTGTCTAAACACCAGGTCAACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAA
CAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGA
TTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAATAG
AAGTCACGCGTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGCCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGAT
CATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTT
GGCCAGCTTCTGGCGAGCCTTGTCAGAAGATGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGCGTATATGCGGCCTTCACGTCATCCAAC
AAAGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCGCCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGA
CATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGC
CGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCC
TTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGC
ATCCGATCGCGAAATCGGATGCATCGCACACAACGTGAAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGC
TTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTAC
TTGCACAAGTACGTGGCGAGTCCAAGGAACTGCTGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTTATCACTCTGACCTTTCCTGGGTCAGGGC
GTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAG
CTCAAGTAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCG
AAGTCGCGGGGGCGTTCTTCAGCCCCTGCGACATCACGAGTCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACG
CATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTC
TGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGCGGGGCGCGCTGTGCGGG
GACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTAACGT
AATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACG
CAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCA