Description :
From Genome Similarity Track
Location :
Scaffold_1970:631- 3387
Sequence
2756 bases(100 bases per row)
TGGAGATTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAATGGACTCCTTCTGGGTTTGG
ATTTACTAAAGGGACAAGATCCAAAGCGGCTGGTAATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGC
CCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGT
TTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCGACTTGACGAAGTGGTAG
TGGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAA
GAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGGGATCTGAGTCGG
GAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGGTC
GGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTACCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCG
GACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGC
AGGCCCACAATCGAAGGGGGGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCA
AAGGAAACACAGAATTGTTGATTTGGGCGGACTTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTA
CGAGGAGTGCCTTTTCCGAAGATTTGGAGCTAGTGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATC
CTGGGGCAGAGACAGCGAGCAACCATGGCATACCGTTTCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATG
TCCAGGATTTGGATCAGATGGATTGGGATGAGTACGCAGAACGACTCCCCTTTGCGATGAACACCGCCCAAGACAGGATCCGAGGTGATACCCCATTTTA
CTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCAGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAA
GTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGACTGCGGAGTGCGATACAGGAGCGAGCGGATCGACATAACGAAGACGCCCGTCCGC
ATCAAATCCAAGTGGGATCGCAGGTATGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGGCCGTTCCGGGT
GAGCGAGATATATATATATATAGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAG
TTGGTCAAAGAATATCCAGATCGGCCGCAAACCCGTCTTTCGGTGGATGGATCCGACCGCGTCGACTTCGACGAAGTCCTCCTACCGGAGGATAGCTGGA
ATGTGGACCTCGAGGCCGACGAGTTCGAAGTCGAGAAGATCACCGACATGAGGTCAGGGAAGCGAACTAGATACGGGCGGATTTACCGTGAATTTCTGGT
GTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCAATGGTTTCTTGCGGGATCGTACGAATCGTAAC
AGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGATCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGAACCCACAGGAAG
GGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGAAAGAAACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACTGGACC
TTGTAAACTACTTATATAGGCCAACCAGTAAAATAAGAACACGCTACTAGCACGAGCAAAGCTAGCAGGCGTTTTGAATCCTCGTGGTCCCAACAGCGGA
AGGGTACCAGGCACGGGTAAGCCTTTTACGAGATCACCTAGTGTTCAACACTCGGCTGGAAGAAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGC
AAATAGGCAACAATAAGCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGAGCTT
CGAGTTCACCGACAGGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCCTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTCT
GTATCCAAAGCTTACCCTTTCGGGTCTATTTCTTAATAAGAAGTCCTAATCCAGTA