Description :
From Genome Similarity Track
Location :
Scaffold_17:63094- 99034
Sequence
35940 bases(100 bases per row)
GATCGTGACCGGACACGCGACGCACAAAGAGCTCGCACGAGACGAGCGAATATGTCACTCTCTCAACGTAATATCGCCCGACAGAAGGGTGCAGAGCGCC
AACGTGTCCGTCGAGCTCGGCTACGCGAGGAACAGCTTCAGGAACTACGGGAGCAGGACCGAGCTTACCATGAAGAAAGACGTGCGGAGTTGCCTTCACA
GGATCGTGAAGTGGAACGTGAGCTAAATCGCCAGCAGCATACGGATCGACGAGCGCGACAGACAGCGGAAGAGCACCAGCAAGAGCTCGAGCGGGTGCGC
ACTCGACGCCAATGCGTCCGTCATGGCCACGCTCTTATTTCCCTCGCAGACTTCGACGCGTCCATGATAACGGGTGACCACGTGGTTAGCGGGCGACACA
AGCTCCCGGCTACAACCGTTTGTCCGGTCTGCAATGCTTGGAAGTGGCCAGGCGAGTCTGCGATATCATGCTGTCTGGCAGGCAGGGTAAAGCTGCCTCC
ACTGCACCCCGCGCCACCAAAACTTCTTCAGCTGTACGGAGATCCCGAGTTCCGCCGTCAAATTCGTGCCTACAATCAAGCCTTCGCGTTTACGTCGATT
GGTGCTTCGTGCTCAAACCGGTCGTTTTAAAATGTGCATCAAGACGAGAGCGTTGCGGGTACACACGGGGTGTACACATATCGCATTCAAGGGGCTATGG
GGCACTACCTAGGATCTCTCCTCCCCCACATAGACCGTCGGACAGGCGCGCGAGTAGCACCCAAGTTTGCGCAGATCTACATTGTGGATCCAGACATGCA
ACGCCGCGCGGAGCGACGTCTTGGTATATTCGCGGATCTGGATCGTGTTGCACTACTAGACATCGAGAAAATGATGGCAGAGCACAACCCATTAGCGCAA
CGGTTCCTCCACTTTGGGCAGCAAGTGCGTCAACACAACACGGAGACTCCAGTAGATTTGGTCTTCCGTCTGCATGATAACTCCTCGCGACCGAGGACGC
ATAACCGCCCCACTGTGTCTGAAGTGGCTGCGACTCTCATTGAGGATGGCAACCTGGCTCAGCCTCGGGATCTACTGCTCTTTACACGCGATCAAAGGCT
GCTACGTTTGTATGAGACTCACGCCGATTACGATCCACTCCAATACCCGCTTCTCCTTCCATATGGAGAGAAGGGCTGGACCTACACAGACGAGTTCGCG
AATGGTGCTGAGTATCGAAACAAGAAGGCAATGTCGCTTCGTGAACACGTCGCGTTCCGCCATCATCAGAAAGTGGGTGACCAGTCCGCTCTCCACCAAG
GCGGGCGTCTATTTCAACAGTGGTGTGTAGATCAGCGTGCAAAATGTGAGCAAGAACAGCTTCGCTGGGTGGCCGACAATCAGAAAACACTTCGCGCCGA
TCAATACAGGGGTGTTCAAGACGCTTTGCTCAACTAAGATACTTTGGCTCTGGCGGAAGGAGAAGTGCTGCTGTCGGAATACGACCGGGTCCAGAACAGA
TTGGTGCACCCGGACCAGGACGGAGGCAACAGAGGACGACCTACCCACTTTCTTAATCAGGTTGGCAAACGTATCATACTACCGGCTTCGCACCTGGGTA
GCCCGCGGTCCATGTACAAGTCGTATCAAGATTCGATGGCAATTGTTCGGGAGTATGGACGGCCCGACGTCTTCTTGACGGAAACGTGCAACCCTAAGTG
GGACGAGATTCTTGAAGCGATACCTTCCGATATCCAGACAGCTCAAGATCGACCTGACATCGTGGCTCGCGTGTGGCAGCAGAAACTGCAAGCGACGCTT
GACGATTTAAACCAAGGCGTCCTGGGGCGAGTGCGCGCGCGGATTTACGTTGTCGAGTTTCAAAAACGTGGGCTCCCCCACGCTCACGTATTGATTATTC
TGGCTGACGAAGACAAACCTCGAACGCGCGAGATCGTAGACAAGATGGTATGCGCTGAGATCCCAGATAAGGATACAAACCCTCAGCTGTATGAGACGGT
CATGTCATGCATGCTCCATGGTCCATGTGGGCCTGCAAACCCTTCCTGCGCGTGTATGAAGGACGGCAAGTGCACCAAAGGATATCCGAAGCCCTTAGCA
GAAGTTACACAAGCCAATGCCAACGGATATCCAGTGTACAGACGACGTCGACGGCAAGAAGGTGTTCTAAAGTTCAAAGGCAGAGAATACGACAATGCTA
CGATCAACCAGTGGGTTGTACCGTACAACCCGTACTTATCCCAGAAGTACAACTGCCACATCAATGTGGAAGTGTGCACGGATATTACTGCGGTTAAATA
CCTGTACAAGTATGTGTACAAAGGACCCGACATGGCTATACTCACTGGGAAGAAGTCCGAGGAGGGCAGCAGAGTGCGCGTCGAGAACCAAATGAGATTC
TACGTTTCTTGAGCGCCCGTTACATTTCTCCGGTGGAAGCTTGCATGCGCCTGCTCGATTTCAGGATTCAGGGGAAAACCCATGCGGTGACACAGCTGAC
GGTTCATCTCGAGTCAGGGCAGACGGTTTGCTTCCGCGAAACGGAAAACCCGGAGGCGGTTTTGGAACGTGGTAGTCACACGATGCTGACCAGATTCTTT
GAGTTGTGTGCGAGTGAAGAACCTCAGAATCATATTGCCAGAACGATGTTGTATCAGGACATCCCTAAAGAGTTCTGCTGGAAAGCGCCGGAGAAAGGGC
AACCGAAAAGGTGGGTTCGCCGGAAACAGTATCAAGCAGCTGTGGTCGCATGATTCACGTGTCTCCTCGAGATATGGAGCGGTTCTACCTTCGGCTACTA
CTCTGTCAGCGTAGAGGCCCAACGTCGTTTGAAGACTTAAGAACGGTTAACGGGATTGTCTGCCCAACATTCCAAATTGCGGCGCGGGAGGCTGGCTACT
TGGAGAATGATAACGAGTGGGTTTCGTGTTTGAGGGAAGCGGCTGACTTCCAAATGCCGTATCAACTACGCCAGCTCTTCGTCACCATTCTGGTGTATTC
AGCTCCAGCAAATGTTGGTGCTCTATGGGATCGGTTCTTCGCGGATCTTTCCCAAGACTTCGCACGCAAACATCAGGCTTTGATGGACCCCTTCAAGTCG
GCGTTGATCGAATTTGAAACGCTGATGAGCATTCAAGAACTACTTCAAGCGAGTGGGTATGCGGTAGCTGACTTCGACGAACTTCCTCAGTTGGGGTCGT
TCCCAACATTGATTCGTGAAGCGCTTCGACAGAATGGATTACTACGACGTGAGCTCACTGGATACGACGCGTCAGCTTTGGAGGCGATTGTAAACACAGA
AGATCAGCTAAACGAAAATCAGCGGGTGGTTTACGACCAGATTATTGAAGCGGTTCAATGCCCGGAGGAAGGCAAGAAACTATTTTTTGTCGATGGCCCG
GGTGGTACTGGAAAATCTACACTGCTTCGAAACATACTGGCCAAAGTCAGACTCTCGGGGAAAATCGCCATCGCTGTGGCGTCTAGCGGTATTGCCTCGC
TCTTGCTCATGGGTGGTAGGACAGCTCATTCTACATTCAAGATCCCTTTGAAATTGAACGAGAGCTCGACGTGCGGTATCAGGAAGAACTCCCATATTCA
GGAGTTGATTAAGCATGCAAGTTTAATTTTTTGGGACGAAGCACCTATGGCCCATCGCCACGCATTCGAGGCAGTAGACCGAACACTGCGGGACATACTT
GACAACGATACCGAGCTTTTCGGGGGGAAAGTGTTTGTACTTTCGGGAGATTTCCGCCAGATTCTCCCGGTCGTTAAGAATGGAACACCCGTCAAGACAA
TTGACGCTTGCCTCAAGTCGTCTAGGCTGTGGCCCCAATTCCAGACGTTCCGTCTTACGGAAAACATGCGAGTGCGCACAGCTGATACTGCAGACACTGC
TGAGGAAATGGCTGCGTTCTCCGAGTTCCTGCTGCAAGTCGGGGAGGGAAGGCATGATGTAAACCCTTCCCTAGGAAACGATTACATGAAGATCCCGCGC
GATATGCTGATTGAGAATCCACCTGTGCCTGAGGATGAGGACCAGGAAATTCGTCCGGGCGTTATTCCAAGAGGCATGGATCGGATCATCGACGAGATGT
ATGGCGAGATTAATAACCCCGAGGTTGCTACCGACGAGTATTTCGCTAACCGAACGATCCTCACGACCACGAACGCAATCGTGCACCGCATCAATGAAGC
GGTGACCGATCGATTAACTGGACAGGCGCGGGAATACATGTCTTCCGATTCTGTACAAGACGACGGTGATGGCAATTTCTTCGAGCAGGAGGTACTCCAC
TCGATGAATATCAGTGGAATGCCGCCCCACAAGCTGACCCTCAAGGTAGGAATGCCTATCATGATGATGCGGAACCTGAATCCAGATCTAGGGCTGTGCA
ACGGAACACGGCTTCGAATTGTGGCCCATAAGCCACATGTCATCCACGCCACAATCATGACCGTGAGCGACAAGGGCAACATGTGTTGATTCCCCGCATT
GTTTTCATCAGTGACGGAGACATTCGGAGCTTTCCGTTTCATTTGAGACGCAAGCAGTTTCCTGTCCAACCGGCCTTTGCGATGACGATTAACAAGGCGC
AAGGACAAACGGTGCAGTACTTGGGGCTGTATCTTGCTACGCCTTGCTTCTCCCACGGGCAGCTGTACGTTGCGATGTCGCGAGTTACTTCAAGATCAAG
ATTCAAGGCGCTGGTCGAGTACCCAAAGCTGGAGGAGGAGGATGGGGTCTACGCCCAGAATATTGTCTACAGACAGATCTTTGGTTCGGAGTAGGAATGT
TCAACTTCAAATGCATTTAATACATAACGTTTACATAAAACATGTTTAAGCGCAGCGAAGGCGTGAGCCCATTTCCCCTGGGACTACAGCCTGCCACCTC
CGCCGCGTAGCGGCGGCGAACGGCTAGTCTTACCCCTCTAGTGGAGTGTGTTGTCCGTCTGTAACGTCCGTAACGGGCTAGGGTTAATAATCCTCACGCT
AAAACGCGCGTTCTACTGGCTGCCGAGCGCAGCGAAGGCGGCCTCGATTGGCTAAAATCGCAATATGTGGTGTACACATTGTATGTGGGCTACATATCGT
ACTTAAATGCAAACGTTCAAATTTCATTTTGCCCCCATTTTCGAAACGGAAGCCGCGGAACGCCACGTTACTCAAGGTACGCTGCGTGTATGCATGTTAG
TTAGCATTAGTAGCTAGCAAGACACACATACACAGATAGTCCGAGGTTCCTGGGGCTGCTTAGGGGGTAGCTTATAACTTGCGGGATTTTATCCTGCAAG
TAGGTAGCCGTGCTATGGGGATTTAGCTCCAGAGCCCTTTGGGTTCTTGGGGCTTTATCCCACCGCCCACTCTGCGCGAGAGCACATTTGGCACCTGGTC
CATAGACCGCAAACCCGACAGCGAACCAGTTGAGCCGGTCGTTAATGGTTATTGATGGGCACGCACATTGCGTCCCTACGCTTGGTTAGGAGGGGTACCG
TAACCGGCCTCTTTTTTATCGAGATGGGATGGGGGCTGTAATAGCCTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCTCTCTCTTTTACAGCCGAATCACAGATGAGTCTGTTTTGATGAGATCTCTAGTCCGATAACGGTCTCGCTTCCAAATACCCG
CTTTTTCGTTTCCATATGGAGAGAAGGGATGTGACCTACACAGTCGAGGTCGGCGAATGGGTGCTTGAGTTATCGGAACCAAGAAGGCGATGTCGCTTCG
TGAAACACGTCGCGTTTCCGCCTCCCACCAGAAAAGTGGATGATCAGTCCGCTCTCCAACCAGGGTGGGCGTCTATTTCAGCAGTGGTTGTGTAGATCAG
CGTGCCAAAATGTGAGCCAGAACAGCTTCGCTGGGTGGCCGACAATCAGAAAACACTACGCGCCGATCAATACAGGGGTGTTCAAGACGCTTTGCTCAAC
GAAGATACTTTGGCTCTGGCAAAAGGAGAAGTACTGCTGTCGGAATATGACCGGGCCCAGAGCAGATTGGTGCACCCAGACCGAGATGGAGGCGGCAGAG
GACGACCTACCCACTTTCTTAATCAGGTTGGCAAGCGTATCATACTACCGGCTTCACACCTGGGTAGCCCGCGGTCCATGTACAAGTCGTATCAAGATTC
GATGGCAATTGTTCGGGAGTATGGACGACCCGACGTCTTCCTGACGGAAACGTGCAACCCCAAATGGGACGAGATTCTTGAAGCGATACCTTCCAATATC
CAGACAGCTCAAGATCGACCAGACATCGTGGCTCGCGTGTGGCAGCAGAAACTGCAAGCGACGCTTGACGATTTAAACCAAGGCGTTCTGGGGCGAGTGC
GCGCGCGGATTTACGTTGTCGAGTTTCAAAAACGAGGGCTCCCCCACGCACACGTACTGATTATTTTGGCTGACGAAGACAAACCTCGAACCCGCGAGAT
CGTAGACAAGATGGTATGCGCTGAGATCCCAGATAAGGATACAAACCCTCAGCTGTATGAGACGGTCATGTCATGCATGCTCCATGGTCCATGCGGGCCT
GCAAACCCTTCCTGCGCGTGTATGAAGGACGGCAAGTGCACCAAAGGATATCCGAAGCCCTTAGCAGAAGTTACACAAGCCAATGCTAATGGATATCCAG
TCTACAGACGACGTCGACGGCAACAAGGTGTTCTAAAGTTCAAAGGCAGAGAATACGACAATGCTACGATCAACCAGTGGGTTGTACCGTACAACCCGTA
CTTATCCCAGAAGTACAACTGCCACATCAATGTGGAAGTGTGCACAGATATAACTGCGGTTAAATACCTGTACAAGTATGTGTACAAAGGACCCGACATG
GCTATACTCACTGTGGAAGAAGTCCGAGGAGGTCAGCAGATTGCGCGTCGAGAACCAAATGAGATTCTACGTTTCTTGAGCGCCCGTTACATTTCTCCGG
TGGAAGCTTGCATGCGCCTGCTCGATTTCACGATTCAGGGGAAAACCCATGCGGTGACACAGCTGACGGTTCATCTCGAGTCAGGGCAGACGGTTTGCTT
CCGCGAAACGGAAAACCCGGAGGCGGTTTTGGAACGTGGTAGTCACACGATGCTGACCAGATTCTTTGAGTTGTGTGCGAGTGAAGAACCTTAGAATCAT
ATTGCCAGAACGATGTTGTATCAGGACATCCCTAAAGCGTTCTGCTGGAAAGCGCCGGAGAAAGGGCAACCGAAAAGGTGGGTTCGCAGGAAACAGTATC
AAGCTGCGGTTGGTCGCATGATTCATGTGTCTCCTCGAGACATGGAGCGGTTCTATCTTCGGTTACTGCTCTGTCAGCGTAGAGGTCCAACATCGTTTGA
AGACTTGAGAACGGTTAACGGGATTGTCTGCCCCACATTCCAAATTGCGGCGCGGGAAGCTAGCTACTTGGAGAATGACAACGAGTGGGTTTCGTGTTTG
ACGGAAGCGGCTGAGTTCCAAATGCCGTATCAACTACGCCAGCTCTTCGTCACCATTCTGGTGTATTCAGCTCCAGCAAATGCTGGTGTTCTATGGGATC
GGTTTTTCGCGGATCTTTCCCAAGACTTCGCACGCAAACATTAGGCTTTGATGGACCCCTTTAAGTCGGCGTTGGTCAAATTTGAAACGCTGATGAGCAT
TCAAGAACTACTTCAAGCGAGTGGGTATGCGGTAGCTGACTTCGACGAGCTACCTCAGTTGGGGTCGTTCCCAACATTGATACGTGAAGCGCTTCGCCAA
AACGGATTACTACGACGTGAGCTGACTGGATACGATGCGTCATCTTTGGAGGCAATTGTAAGCACAGAAGATCAGCTAAACGAAAGTCAGCGGGTGGTTT
ACGACCAGATTATTAAAGCGGTTGAATGCCCGGAGGAAGGCAAGAAGTTATTTTTTGTCGATGGCCCGGGTGGTACTGGAAAATCTACACTGCTTCGAAA
CATACTGGCCAAAGTCAGACTCTCGGGGAAAATCGCCATCGCTGTGGCGTCTAGCGGTATTGCCTCGCTCTTGCTCATGGGTGGTAGGACAGCTCATTCT
ACATTCAAGATCCCTTTGAAATTGAACGAGAGCTCGACGTGCGGTATCAGGAAGAACTCCCATATTCAGGAGTTGATCAAGCATGCAAGTTTAATTATTT
GGGACGAAGCACCTATGGCCCATCGCCACGCATTCGAGGCAGTAGACAGAACACTGCGATACATACTTGACAACGATACTGAGCCTTTTGGGGGGAAAGT
GTTTGTACTTTCTGGAGATTTCCGCCAGATTCTCCCGGTCGTTAAGAATGGAACACCCGTCGAGACAATTGACGCTTGCCTCAAGTCGTCTAGGCTGTGG
CCCCAATTCCAGACGTTCCGTCTTACGGAAAACATGCGAGTGCGCACAGCTGATACTGCAGACACGGCTGAGGAAATGTCTGCATTCTCCTAGTTCCTGC
TGCAAGTCGGGGAGGGAAGGTATGATGTAACTCCTTCCCTAGGAAGAGATTACATGAAGATCCCGCGCGATATGCTGATTGAGAATCCACCTGTGCCTGA
GGATGAGGACCGGGAAATTCGTCCTGATGTTATTCCAAGAGGCATGTATCGGATCATCGACGAGATGTATAAGCGGGATTAACAACCCCGAAGTTGCTAC
CGATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAAGCGCTCTACCTAAATACAATCCTTGTAC
TCAGCACCACACCAAACACAAGCTAATACGCGCGTTCTACTGGCTGCCGAGCGCAGCGAAGGCGGCGTCGATTGGCTAAAATCGAATTATGTGGTGTACA
CACTGTATGTGGTCAACACATCGTACTTAAAATGCACCACTCAAATTTCATTTTGCTTTCATTTTCAGCTGCGGTATGCAAGGCCACGCGAAGGGCGCTG
CCTGTGCACGCGTTAATTAGCATTAATAGGAGGCGCCGACGTGCACACACATACAATATCGTCGTAGGAGCTGTTGAATTTTTTTGTAGGCCCTGGTGAC
TTATATTTAGGCCTCAATCGAAACTTTAGTAGCTATTGAATATAGAATGATATTTTAGGCTTCATAGTACTTTTCCAGAAATTAAACTTACAATGCTGTT
TTGAGTAGTACTATTATCAAGACAATTCCTATTTTTCCTTGCAGCTATTTGTTGTAGTAGTAGTACACATAATTATAATATCAGCGTTTTATAATAAATA
ACAATTGTATTACTATTAATAATAATGTGAAAAAAATGACTATTGTGGCTTACACCCCTGCACTCCACACTGCCTCCGGGGAAAAGTATCATCTTCCTCT
GTATTTTTGCACGTAGTGTGCGACCTTAACATATTGTGTGAACTTTCCAGCAGCTATTGAATATAGAATGATATTTTAGGCTTCATAGTACTTTTCCAGA
AATTAAACTTACAATGCTGTTTTGAGTAGTACTATTATCAAGACAATTCCTATTTTTCCTTGCAGCTATTTGTTGTAGTAGTAGTACACATAATTATAAT
ATCAGCGTTTTATAATAAATAACAATTGTATTACTATTAATAATAATGTGAAAAAAATGACTATTGTGGCTTACACCCCTGCACTCCACACTGCCTCCGG
GGAAAAGTATCATCTTCCTCTGTATTTTTGCACGTAGTGTGCGACCTTAACATATTGTGTGAACTTTCCAGCAGCTATTGAATATAGAATGATATTTTAG
GCTTCATAGTACTTTTCCAGAAATTAAACTTACAATGCTGTTTTGAGTAGTACTATTATCAAGACAATTCCTATTTTTCCTTGCAGCTATTTGTTGTAGT
AGTAGTACACATAATTATAATATCAGCGTTTTATAATAAATAACAATTGTATTACTATTAATAATAATAGGAAAAAAAAAAAAAATGACTATTGTGGCTT
ACACCCCTGCACTCCACACTGCCTCCGGGGAAAAGTATCATCTTCCTCTGTATTTTTGCACGTAGTGTGCGACCTTAACATATTGTGTGAACTTTCCAGC
AATATATGCTATGTACATCAAACAAAATCGGACCAGAGTTTGTGATTCAGCTGGCGCGGAGGCACGTGACTCAGCAAGAACACGAAACACGAAAGAACAC
CGACCCACACTATGTAGACGATAGGATAGAAGAGCAACACGAAGCACGGAAGGTCATGGACGATGATAGAAGACTTAGCCGATGCAAACCACAAAGTTGT
AGGTATTTTAATTCGTTTATTTTTTGAAATTTTTTTTAATATTTCATATTTTTTTGAAATTTTTTTTTATATTATTTCATTTTTATCTATGTTAATAGGT
GCATTATCCGCATTACAGCAAAAAAAAATTAAAAGATTATTAGCTTATAGTTCTATCAGTCATGTAGGTTTTATTTGTAGCGAAGCGTGCCAATCGAGAC
TTCAAGGAGGTGGAAGCAAGGAGTTTGCAACTGCCGACGGTCAACGTGGTCGCTGTAACCGAGGGCGAGTGCGATGAGACGGTAAAGCCGGACAAGATGG
TAGAACGAGAGTTCGAAAGGAACGTGTGCGTCAGACTGGACGAAGCGACCATCCCGGTATCTCGAGACTGTGAAGACAGTAGCGGGATGCTGCCGTCTCA
ATGGCGTGCAGAGGTTCGAAGGCTGGTGTACGAACTCGTGAAGTAGGATTGGGGTGCAAAGAGAAGTCTCCCTCCGAAAACAACGGAGCCTCCGAGAGAG
AGAGGTGGCGAGGGTGAGGATGACCCTCGGCGTGACGCCGCGACTGAGAACGTTCTGGACGAAGGGGCGCTCCGTAGCCACCTTTGTGAAGTTGGGGGAA
TGCTTAGCGAAGCGTTCCTAAATGGCGCAATAGTCTGGGCTAGAAGTTATTTTGAGGCGGAGGTCGGCGCTATTTGCGACAAGTTACGCGACAGGGCGCC
TGCGTCACCAAAAACAACTGGACCCGTTGGGGCGACCGCTACAGAAACTCTGCGAATGGGAGCGACGCCTGGTTTGCCAATCAAAACGCTGGAAGTTAAA
AAGCTCGAATAGGCCGAAGAGGAGCCAGAGATCTATTTCGTGGACGCGAAGAGAGCCCCCCGCCCTCGGAGACAATCTGGCAGGTGCGAGCGGAGCTACG
AAGTCTTCGATGATGATGATAGGGGTGGTGCCTGAAAGGCAACGAGTTATATGCAGTGGTTGGAGGGGATAGAAGCTCTATCGGACGGTAAACAATTCCT
GATGCCTCATAGGAAGAAGATGGCACGAACACCGCCGCTATTGAGTTAGTTTGGTAGGAAAACACGGTATTCGAAACCGAGTCGGAAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAAAATACAA
ACATAGAACATAACAACACGTGCAAGAAACGGATCCGCGTGATGCCTTCCTCAGAGATCAGATGCCGGGCGCGGACCCCACGACTGCATGAGGCATAAGC
ACGGTATATCACCCTTGGTAGAGTACCGCGATGGGAGCCAACGGCCACGAATGCCTATGTATCACGAAAGCGGTACAGCCCGCGTAAACGTTGAGAACAG
AGAATAGCTAGGAGCCACGAAAGAGGCTGTACTAAAGTGCATAAGCTCAAAAGAGAGCGCATATCCACAAACAGCGTGGACCACGGTGAACAGAGAGCCA
CGAAACCAGTAGAACACGGAGAGCACAGCCCATGAGAACAGACATTCAACGTGATTACGGTAAACGGAGACTACCAAACCAGTATTTTTTCCCAAACCCA
CGGAGGTTTAGCGATAATTTAGGTGTTGGATTACACGGAAACCCGCGCCTATCGAGGTTAAAGGACGCCCACAAAGACCCCCGCGACACAAAGAAGCACT
ATATTTGCGGCCACCTCATCTCCAACAAACCATGCCACTCCGCCGCGTAGCGGCGGCGAACGGCTAGTCTTACCCCCCTAGTGGAGTCTGGTGTGCGTCT
GTCAGTCCGTCCGAGGGTAGGGTTAATAAAATGTAACGCAAATACGCGCGTTCTACTGGCTGCCGAGCGCAGCGAAGGCGGCCTCGATTCGCTAAAATTG
CAATATGTGGTGTACATATTATATGTGGTCTACACATCGTACTTAAAATGCACAGTTCAAATTTCATTTGCCCCCATTTTCAAAACGGAAGCCGCGGAAC
GCCACGTTACTCAAGGTACGCTGCGTGTATACATGTTAGTTTGCATTAGTAGCTAGCAAGACACACATACACAGATAGTCCGAGGTTCCTGGGGCTGCTT
AGGGGGTAGCTTATAACTTGCGGGATTTTATCCTGCAAGTAGGTAGCCGTGCTATGGGGATTTAGTTCCAGAGCCCTCTGGGTTCTTGGGGCTTTATCCC
ACCGCCCACTCTGCGCGAGAGCACATTTGGCACCTGGTCCATTGACCGCAAACCCGACAGCGAACCAGTTGAGCCGGTCGTTAATGGTTATTGATGGGCA
CGCACATTGCGTGCGTGCAGTTGGTCAGGAGGGGTACCGTAACTGGCCTCTTTTAACCGACAGATGGGATGGGGGCTGTAATAGCCTATCAATCACCAGC
CTTTGCAATTAACGGCCGCCTTTTGGCAAAAGGATATCGCACCTCAAGCTACAGTACTATCCGGGGGCCCAACCCTGAAGATTCGACTGCACAATTTGCA
AACTAACACCGCTCCGGGCCTTACGGCCCGTGACTGTGGGATAAGTGATCGGAGATAACCTTGATGGGGGCAAGCAATCCCGGGTAGTACGCGTATTCCA
ACACACTATTCTATGAAAACCTACTGCTACGTGCAGTGTACTTAGACATTGTCTAACGCGTCACGTTTTCGTGTTCGCAGAACTATGGTTCGGAGTAAGC
GAAAGAGGACGCGCGAGGAACTCGAGGAGGCCCAGCGCGAGAACGAACGCATTAACGCGACACCCATGCAAGAGGAAAAGGATGCGCGAAAACGACGTCA
GACCAAGCGCAGAAAGAAAAGATACGACTTGAACAAAGAGCTGAAGGCCCTCAGCGTGCACCAAGACGAGACAGATATCACAGAAGCGACGGAAGTTCTG
GCTGATCGTATGGAAGAGCAGGAGGAGAAAATCGGAAGAGTCCGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAATGTTGGTGGTCCTACCCTGTATGTCGTTCAAACTCCATCGTCCCTTTA
AAACTCCACCACCTCGAAATTTCAATTTTGCTTCCATTTCAGCTTGCCGTATGCCAAGGCCCACGCGAAAGGGCGCCTGCCTGTGCCCGCGTTTATTTGG
CATTAATAGGAGGCGCCGACGTGCACACACATACAATATCGTCGTAGGAGCTGTTGAATTTTTTTGTAGGCCCTGGTGACTTATATTTAGGCCTCAATCG
AAACTTTAGTAGCTATTGAATATAGAATGATATTTTAGGCTTCATAGTACTTTTCCAGAAATTAAACTTACAATGCTGTTTTGAGTAGTACTATTATCAA
GACAATTCCTATTTTTCCTTGCAGCTATTTGTTGTAGTAGTAGTACACATAATTATAATATCAGCGTTTTATAATAAATAACAATTGTATTACTATTAAT
AATAATGTGAAAAAAATGACTATTGTGGCTTACACCCCTGCACTCCACACTGCCTCCGGGGAAAAGTATCATCTTCCTCTGTATTTTTGCACGTAGTGTG
CGACCTTAACATATTGTGTGAACTTTCCAGCAGCTATTGAATATAGAATGATATTTTAGGCTTCATAGTACTTTTCCAGAAATTAAACTTACAATGCTGT
TTTGAGTAGTACTATTATCAAGACAATTCCTATTTTTCCTTGCAGCTATTTGTTGTAGTAGTAGTACACATAATTATAATATCAGCGTTTTATAATAAAT
AACAATTGTATTACTATTAATAATAATGTGAAAAAAATGACTATTGTGGCTTACACCCCTGCACTCCACACTGCCTCCGGGGAAAAGTATCATCTTCCTC
TGTATTTTTGCACGTAGTGTGCGACCTTAACATATTGTGTGAACTTTCCAGCAATATATGCTATGTACATCAAACAAAATCGGACCAGAGTTTGTGATTC
AGCTGGCGCGGAGGCACGTGACTCAGCAAGAACACGAAACACGAAAGAACACCGACCCACACTATGTAGACGATAGGATAGAAGAGCAACACGAAGCACG
GAAGGTCATGGACGATGATAGAAGACTTAGCCGATGCAAACCACAAAGTTGTATGCGTAGCGCGAAAGACGATAGGGCACATATCCATGAAAAGGACAGA
AGGACAAGAATATGACGGAAGCGTACGGGCACGGAAAGAAACTTAAATACATAGACACCCCAGCATGCTGAAATGCACGGCTAAGGAAGAGCACGCTACT
TCGAAGGCACTGTAGAGCACGTAACGGTAAGAGTGCATGGACAGTAATTCTCTCGTAGCACCACGGTAGAACACAGAGCACAGTCGACCGACCAAACATG
AAGCCGCGGAAGACCATTAACGGGAGGTTGTCGAGTATTGAAACACGATACCAGGGTAGAACCGGAGCTCACTGGGGAGCGCGATACTACTGTAGATAAC
GAAAGCTTGGACGACAGACCAACCGCGACACCAAGAGATAGCACGATAGCATGGACGATGGGACAGCCACTAATACATGGGAGAACAAGCAGCCACGGGA
AATCACCGAGCCACTGAGTACGATAGCACTGTAGAACCTGAGATCGCCGGGCCACTGAGGACGATACTTCATTAAAACACGTTTACCCGAACGGCCGACC
AGCCACAAAATCGCGGGGAAACGCTTCTGGAGACCAAGATTGTACACCTCGGAACACGGAACCATCGTAGAACGCGATAACATTGGCAAAACATATATAC
TATGCAGCCACGATAGCATAGACAGCATAACCACATTGTGATTGCACGATAGCGCGATAACGCGGTAGATGGAGCCACCACAGGGGGGCGCGGCACACAG
GTGACAGAAAAGCTCGGAAGATCACCCATTGGCGAGGGTTCCAGAAATGGAACGCTATCGACCATGAATGATTATGGACACAAAGCCTATGAAATCCACG
TAAACCCTTGAGAACACGGAATATCTAGCAGCCACGAAAGAGGGTCGTACTACGGGAGCGCTTGAGACCAAAGGAGCTAGCACACAACCACTAAGCACTG
TGAGAGATGAGTCCACAAATCCAGGACAATCACTAAGCAGAGTGGGCCACGGGTGAGCAGGGTATGCAGCCTCGTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
CACCTATGGCGAATCTGAACGATCTTCGATTCAGCAGTCAGTCGCCGCTCGTGCTCGGGTGCAGCAGACTACACGCGCTGACGATTAACAAGCGCCTGGC
GAGTGCGCGCGATTACGTGTCGAGTTCAAAACGAGGCTCCCCACGCTCACGTATGATATCTGCTGACGAAGACAACCTCGAACCGCGAGATCGTAGACAA
GATGTATGCGCTGAGATCCAGATAAGGATACAACCCTCAGCTGTATGAGACGGTCATGTCATGCATGCTCCATGTTCCATGCGGGCCTGCAAACCCTTCC
TGCGCGTGTATGAAGGACGGCAAGTGCACCAAAGCATATCCGAAGCCTTAGCAGAAGTTACACAAGCCAATGCAAATGGATATCCAGTCTACAGACGACG
TCGACGGCAACAAGGTGTTCTAAAGTTCAAAGGCAGAGAATACGACAATGCTACGATCAACCAGTGGGTTGTACCGTACAACCCGTACTTATCCCAGAAG
TACAACTGTCACATCAATGTGGAAGTGTGCACGGATATAACTGCGGTTAAATACCTGTACAAGTATGTGTACAAAGGACCCGACATGGCTATACTCACTG
TGGAAGAAGTCCGAGGAGGGCAGCAGAGTGCGCGTCGAGAACCAAATGAGATTCTACGTTTCTTGAGCGCCCGGTACATTTCTCCGGTGGAAGCTTGCAT
GCGCCTGCTCGATTTCACGATTCAGGGGAAAACCCATGCGGTGACACAGCTGACGGTTCATCTCGAGTCAGGGCAGACGGTTTGCTTCCGCGAAACGGAA
AACCCGGAGGTGGTTTTGGAACGTGGTAGTCACACGATGCTGACCAGATTCTTTGAGTTGTGTGCGAGTGAAGTGCCCGAGAATCATATTGCCAGAACGA
TGTTGTATCAGGATATCCCCAAAGAGTTCTGCTGGAAAGCGCCGGAGAAAGGGCAACCGAAAAGGTGGGTTCGCCGGAAACAGTATCAAGCTGCCGTAGG
TCGCATGATTCACGTGTCTCCTCGAGATATGGAGCGGTTCTACCTTCGGCTACTACTCTGTCAGCGTAGAGGGCCAACGTCGTTTGAAGACTTGAGAACG
GTTAACGGGATTGTCTGCCCAACATTCCAAATTGCGGCGCGGGAGGCTGGCTACTTAGAGAATGACAACGAGTGGGTTTCGTGTTTGAGGGAAGCGGCTG
AGTTCCAAATGCCGTATCAACTACGCCAGCTCTTCGTCACCATTCTGGTGTATTCAGCTCCAGCAAATGTTGGTGTTCTATGGGATCGTTTTTTCGCGGA
TCTTTCCCAAGACTTCGCACGCAAACATCAGGCTTTGATGGACCCCTTTAAGTCGGCGTTGGTCGAATTTGAAACGCTGATGAGCATTCAAGAACTACTT
CAAGCGAGTGGGTATGCGGTAGCTGACTTCGACGAGCTTCCTCAGTTGGGGTCGTTCCCAACATTGATACGTGAAGCGCTTCGCCAAAACGGATTACTAC
GACGTGAGCTCACTGGATACGATGCGTCAGCTTTGGAGGCAATTGTAAGCACAGAAGATCAGCTAAACGAAAGTCAGCGGGTGGTTTACGACCAGGTTAT
TGAAGCGGTTGGATGCCCGGAGGAAGGCAAGAAACTATTTTTTGTCGATGGCCCGGGTGGTACTGGAAAATCTACACTGCTTCGAAACATACTGGCCAAA
GTCAGACTCTCGGGAAAAATCGCCATCGCTGTGGCGTCTAGCGGTATCGCCTCACTCTTGCTCATGGGTGGTAGGACAGCTCATTCTACATTCAAGATCC
CTTTGAAATTGAACGAGAGCTCGACGTGCGGTATCAGGAAGAACTCTCATATTCAGGAGTTGATCAAGCATGCAAGTTTAATTATTTGGGACGAAGCACC
TATGGCCCATCGCCACGCATTCGAGGCAGTAGACAGAACACTGCGGGACATACTTGACAACGATACAGAGCCTTTTGGGGGGAAAGTGTTTGTACTTTCG
GGAGATTTCCGCCAGATTCTCCCGGTCGTTAAGAATGGCACACCCGTCGAGACAATTGACGCTTGCCTCAAGTCGTCTAGGCTGTGGCCCCAATTCCAGA
CGTTCCGTCTTACGGAAAACATGCGAGTGCGCACAGCTGATACTGCAGACACTGCTGAGGAAATGGCTGCGTTCTCCGAGTTCCTGCTGCAAGTCGGGGA
GGGAAGGCATGATGTAACTCCTTCCCTAGGAAGCGATTACATGAAGATCCCGCGCGATATGCTGATTGAGAATCCTCCTGTGCCAGAGGACGAGGACCAG
GAAATTCGTCCGGGCGTTATTCCAAGAGGCATGGATCGGATCATTGACGAGATGTATGGCGAGATTAATAACCCCGAGGTTGCTACCGACGAGTATTTCG
CTAACCGAACGATCCTCACGACCACGAACGCAATCGTGCACCGCATCAATGAAGCGGTGACCGATCGATTAACTGGACAGGCGCGGGAATACATGTCTTC
CGACTCTGTTCAAGACGACGGTGACGGCAATTCTTCGAGCAGGAGGTACTCCACTCGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACAATGCAGGTCCAATCCGTAAGCAGAATGGGCCAC
GGGTGAGCAGGGATGCACGAATCCCAGAAAGATCACGGAAGAGCGTCGGCCCACTGTAGAACATGACATGCAATCTGTAGTACGAGGTAACGGAAGCGTC
CCACACAACGATATCATACGGGTCCACATGAGAGTACGGAATGGTAAGGGGTTAAGTACATGAAGCCACGGCGTACTGGGGTGAGGGACGCTTACTACGC
ACGCGACACCAAGAAGCAATTACATTTGCGACCACCTTATCTCTAACAAATCATGCCATTGCGCCGCGTAGCGACGGCGAACGGCTAGTCTTACCCCCCT
TGTGCAGTGTGTGGTCTGTCCGTCCGTCAGTCCGTCCGTAACGGGCTAGGGTTAATAATCCTCACGCTAATACGCGCGTTCTAGTGGGTGCCGAGGGCAG
CGAAGGCGGCGTCGATTAACTAAAATAGAATTATGTGGTGTACACACTGTATGTGGTCAACACTTCGTACTTAAAATGCACCGCTCAAATTTCATTTTGC
CCCATTTTCAGCTGCGGTATGCAAGGCCACGCGAAGGGCGCTGCCTGTGCACGCGTTAATTAGCATTAATAGGAGGCGCCGACGTGCACACACATACAAT
ATCGTCGTAGGAGCTGTTGAAATTTTTTGTAGGCCCTGGTGACTTATATTTAGGCCTCAATCGCAACTTTAGTAGCTATTGAATATAGAATGATATTTTA
GGCTTCATAGTACTTTTCCAGAAATTAAACTTACAATGCTGTTTTGAGTAGTACTATTATCAAGACAATTCCTATTTTTCCTTGCAGCTATTTGTTGTAG
TAGTAGTACACATAATTATAATATCAGCGTTTTATAATAAATAACAATTGTATTACTATTAATAATAATGTGAAAAAATACAAAATGACTATTGTGGCTT
ACACCCCTGCACTCCACACTGCCTCCGGGGAAAGTATCATCTTCCTCTGTATTTTTGCACTTAGTGTGCGACCTTAACATATTGTGTGAACTTTCCAGCA
ATATATGCTATGTACATCAAACAAAATCGGACCAGCGTTTGTGATTCAGCTGGCGCGGAGGCACGTGACTCAGCAAGAACACGAAACACGAAAGAACACC
GACCCACACTATGTAGACGATGGGATAGAAGAGCAACACGAAGCACGGAAGGTCATGGACGATGATAGAAGACTTAGCCGATGCAAACCACAAAGTTGTA
TGCGTAGCGCGAAAGACGATAGGGCACATATCCATGAAAAGGACAGAAGGACAAGAGTATGACGGGAGCGTACGGGCACGGAAAGGAACTTAAATACATA
GACACCCCAGCATGCTGAAATGCACGGCTAAGGAAGAGCACGCTACTTCGAAGGCACTGTAGAGCACGTAACGGTAAGAGTGCATTGACAGTAATTCTCC
CGTAGCACCACGGTAGAACACGGAGCACAGTCGACCGACCAAACATGAAGCCGCGGAAGACCATTAACGGGAGGTTGTCGAGTATTGAAACACGATACCA
GGGTAGAACCGGAGCTCACTGGGGAGCGCGATACTACTGTAGATAACGAAAGCTTGGACGACAGACCAACCGCGACACCAAGAGATAGCACGATAGCATG
GACGATGAGACAGCCACTAAAACATGGGAGAACAAGCAGCCACGGGAAATCACCGAGCCACTGAGCACGATAGCACTGTAGAACCTGAGATCGCCGGGCC
ACTGAGGACGATACTTCATTAAAACACGCTTACCCGAACGGCCGACCAGCCACAAAAATCGCGGGGAAACGCTTCTGGAGACAAGATTGTACACCTCGGA
ACACGGAACCATCGTAGAACGCGATAACATTGGCAAAACATATATACTATGCAGCCACGATAGCATAGACAGCATGACCACATTGTGATTGCCCGATAGC
GCGATAACGCGGTAGATGGAGCCACCACAGGGGTGCGCGGCACACAGGTGACAGAAAAGCTCGGAAGATCATCCATTGGCGAGGGTTCCAGAAATGGAAC
GCTATCGACCATGATTTGATATGGACACAAAGCCTGTGGAATCCACGTAAACCCTTGAGAACACGGAATATCTAGCAGCCACGAAAGAGGGTCGTACTAC
GGGAGCGCTTGAGACCAAAGGAGCAAGCACACAACCACTAAGCACTGTGAGAGAATGAGTCCACAAATCCAGGACAATCACTAAGCAGCGTGGGCCACGG
GTGAGCAGGGATCCACGAAGCCAGGAAGATCACGGAAGAGCGCCGGCCACTGTAGAACATGACATCCAACCTGTGGTACGGGGTAACGGAAGCGTACCAA
ACAACGATATTATACGGGTCCATATGAGACTACGGAATGGTAAGGGGTTAAGTACACGAAGCCACGGCGTACTGGGGTGAGCGACGCTTACAACGCACGC
GACACCAAGAAGCACTTCCATTTGCGGCCACCTTATCTCCAACAAACCATGCCACTCCGCCGCGTAGCGGCGGCGAACGGCTAGTCTTACCCCCCTAGTT
GAGTCTGGTGTGCGTCCGTCCGTCAGTCCGTCCGTGGCGGGCTAGGATTAATAATCCTCACGCTAATACGCGCGTTCTACTGGCTGCCGAGCGCAGCGAA
GGCGGCCTCGATTCGCTAAAATTGCAATATGTGGTGTACACACTGTATGTGGTCAACACATCGTACTTAAATGCACCGTTCAAATTTCATTTTGCCCCCA
ATTTTAACGCTGGAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCACCACGATATTGTACAAAGCCACATGAGATTACGGAACAATTAGGGGGTGACTACACGAAGCCACGACGTACTAGGTTCAA
CGACGCCCACAAAACACGCCACACGAAGAAGCACTAAAGTTGCGGCCACCTCATCTCCAACAAACCATGCCACTCCGCCGCGTAGCGGCGGCGAACGGCT
AGTCTTACCTCTCTAGTGGAGTGTGTTGTCTGTCCGTCTGTCTGTCACGGGCTAGGGTTAATTAATGTAACGCAAATGCGGGCATTCTACTGGCTGCCGA
GCGCAGCGAAGGCGGCCTCGATTCGCTAAAATTGCAATATGTGGTGTACACACTGTATGTGGTCAACACATCGTACTTAAATGCACCGTTCAAATTTCAT
TTTGCCCCCATTTTTAACGCTGGAGCGCCACCTCACGCAAAGGGCGCTGCTTGTGCGCGCGTTAGTTAGCATTTGGTAGAAGCGCCAACGCGCACACACG
TAGTATATCGTCGTAAGGAGCTGTTTGAAAAATTTGTAGGCCTGGGTGACTTATATTTCGGCTTAAATGAAGCCTTTAGGACTTATTGGTTATAATATGA
TTTGGTTTAGCTTTGTAGCATTTTTTTTTACTTTCTAAGAAATTTTGCTTAGTACTATTCTAAAGTCTCATATTATTGCTTGCAGACGATTGTAGTAGTA
CTACACAAAATTAATTTAGTAGCGCTTATCAAATTTAAATGCACTTTATATCTAATACTAATAATCTTAAAGTATTGTATCATATTTGCGTTAGATGAAG
ATGCACAATTTATTATTAATATTAAATATTTAAAATATGAATATAGTGGCTTCCACCGCACATAACCATGTACACTTCTCCGCCACTAAAAAAAAGAACG
TTTTCTTTGTATTAGCGCGTATTTTGCACCCCTAAGAGCATGTGCGCCCTCTCGAACACGATACGTAACATACATGCAGTGCAGTGGGAGCAGTGTTTGT
GATTGAATTAGCGTAGAGGCACGTGATTAAACAAGAACACGAAACACGGAGGAACACCGAGTCAGATCATGTACATAACGCGATAGAAGGAACAGCTTGA
AATACGGAAAGTCACGGACGAAATAAGAATAGGCCACGAAATTTCATACGAAGCACGAACCAGGGAAGAGCCTGAAAAACACGGAGCCGCACGATCAGAT
GACAGCGGGTGAGAGCTGAAATAATGAAACGCCAACACGCTGAAAAAGCACGGACCAAGAGAGAGCACGTTCACAGTCACGGTAGACCACGCAGCTGTGC
GAGTGCACGGAAAGGAGTTCTCCCACCACAGGTTACCCCGAAGCACGGTCGACGGCCAAACACAAATTCACGGGAGAGCATAAGCGGGAAATCACTGAAC
ATTGGAGTACGATACGAGGACAGCCCACCGACCCACGGCACACGATACTACGGTAGCTAACGATAGCCTGGACGACCGATCAACGTCAACACCACGCCAT
AAACGACAGCATAGACGTTGGATTAACCACTAAACCGTGGGAGAACACGCAGCCACGCGAAATCACCGAACCACGGAGCCGGGTACCAGTGTAGAGCCTG
AGGTCACCTAGCATCGAGGGACAATAGTGCATTACAACATGATTGCACGGACGACGTGCCAGCCACGAAGTCACAGGGAAACGATTCGGGATACCACGGT
TGCACACCGCGGAGCACGATACCATTGTAGAACACGATACGCGGGCAAAGCAGATGCACTACGCGAGCACAATACCGTAGACATCATTGCCATACCGCGA
TTGCACGATAGCATGGTAACGCGGTCGATGGAACGGGCGACATACCACACGACTGCATGGAGGCACCAACCACGGAATAGCACCTAGACCGAAGACCATC
AAGCCACGGAACACCATACCAGTGGTAGAACCTGAGCTTACCTGAGCCACCGAGGGACAGTAGTACATGAGAACCACGATTGCACGGACGGGTGGACCCA
GCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGTTTGTGATCAAGTTTGCGCGGAGGCACGCGACTCAGCAAGAACACGAAAAACGATGGGATAGAAGAGCAACACGAAGCACGGAACGTCATGGAC
GATGATAGAAGATTTAGCCGATGCAAACCACGAAGTGTTTTACGTAGCGTGAAAGATGGAAGTGCACGCAGCCATGGAAAGAACAGAAGAACGAGAATAT
GACGGGAGCGTACGGGCCACGGAAGGGAACTAAATACATAGACACCCCAGCATGCTGAAATGCACGGCTACGGAAGAGCACGCAACTTCGAAGCCACTGT
AGAGCACGTAGCGGTAAGAGTGCACGGACAGTAATTCTCCCATAGCACCACGGTACAACACGGAGCACAGTCGACCGACCAAACGTGAAAACGCGATGTA
CCATAAACGGAAGATCATCCGAGCATTGGAGCTCGATATTAGGGTAGAATCGGAGCTCACCGAGTCCGACAGCACGACACTACGGTAGCTAACGATCTCA
CGGACGACAGACCAACCGCAACATCGCAAGCTAACACGATAGCATGGACTGTGCCACTAAGCCATAGGGGAGCACAGCCACAGGAGCTATAGACGGGAGA
TCTTTGAGCCACGGAGCACGATACCAGCGTAGAAGCTCAGCTCCCCGAGCCACGGAGGACAGTAGCACATTAAAACTCGATTGCACGGACGACAGACCAG
CCACGAAAATCACGGGGGTGCTTGGGGTGACCACGATTGCACACCGTGGAGCACGAAGCCCATGTAGAGCACGATAACACGGGCAACGCAGATGCACTAC
GCGAGCACAATACCATAAATACCATTACCACACCGCGATTGCTCCATAGCGTCGTAACGCGGTCGATGGAATCTTACCAGGAGAGCGCGATACACGGGCG
ACGGAACAACACGACTGCGTGGAGGCACCAAACCACGGATTAGGACCCTTCAGGTAGAGTACTTGGATGGGAAACCAACGACCACAAAAGACTATGAACC
ACGAAACCAGTGCAGCCCCCGTAAACGTTTGAGATCAGGAAATAGTTAGCATCCACGAAAGAGGGTCATACTACTGAGGAGCATGAACTCAAGAGAGAGG
GTCCATAATTACCAAGCATCATGGACCACGGGTGAGCAGGAAACCACGATGCCGGGAAGATCACATAAGATCGCAGGCCATTGAAGAACATGACTACAAC
CTGTAGTACGGATAACCGAAATGTACCAAATCACGATATTGTACGGGTCCACATGATACTACGGAAAGGCAAGTGGTTAAATACACGATGCCAAGATCTA
CGGGGTGAACCACGCTCTCAAAACACGCGACACCAAGAAGCACTTAAATTTGCGGCCACCTCATCTACAACAAACCATGCCACTCCGCCGCGTAGCGGCG
GCGAACGGCTAGTCTTACCTCTCTAGTGGAGTGTGCTCTGCGTCAGTCCGTCAGTCCGTCCGAGGGTAGGGTTCTAAAATGTAACCCTAATGCGCGCGTT
CTACTGGCTGCCGAGCGCAGCGAAGGCGGCGTCGATAGGCTAAAATCGCATTATGTGGTGTACACACTGTATGTGGTCAACACATCGTACTTAAATGCAG
CGTTCAAATTTCATTTTGCCCCATTTTCAGCTGCGGTTCGCAAGGCCACGCAAAGGGCGCTGCCTGTGTGTGCGTTAGTTAGCATTAGTAGAAGGCTTTG
ATGAGCAGACACGTACTATATCGTCGTAGGAGCTGTTGAAAAAATTTGTAGGCTTTGGTGACTCATATTTCGGCCTTAATTGAAATGAGTACTTATTGAT
TATAGAATGATTTTTTTTTCTAATAATTAATCTTTCAATACTTCTTTTGCGTAGTACTATTCTTAAGACATTTCATATTTTTGCTTGCAGTCATTTGTAG
TAGTAGTCCACATAATAATTAATTTAGCGTTTAATAATAAATAGCAATTGCATTACTATTAATAATGTGAAAACTTTAAAATATGACTATTGTGGCTTAC
ACCCCTGCACCCCACACTGCCTTCGGGAAAAAGTATCATCTTCCTTTGTATTTGCACACGTAGTGTGCCACCCGTAAGATATAGTGTGAATTTTCCAACA
ATATATGTTGCGTACATCAAACAAAATGGGAACAGTGTTTGTGATTCAGTTAGTGCGGAGCCACGTGACTCAGCAAGAACACGAAATACGAAGGAACACC
GACCCATACTATGTAGATGATGGGATACAAGAGAAACACGAAGCACGAAGACCATGAACGATGATTTTATAGGTTTAGTCGATGCAAACCACGAAGTTTT
ATGCGTAGCGTGAAAGATGGAAAGAGCACACAGCTATGAAAAGGACATAAGGACACGAATATGACGGGAGCGTACGGGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGCTGCCTGTGTACGCGTTA
ATTAGCATTAGTAGATGAGCACACACCTACTATATCTTCGTAGGAGCTTGATAAAATTTGTACACTTTGGTGACTCATATTGCGGCCTCAATCGAAGCTT
TAGTACTTTTTGATTTTAGAATGATGCTTTTGGCTTCGTAGTAAATCCTTTTTAATACTTAAACTTACAAAACTGTTTTGAGTAGTACTATTCTTAAAAT
ATATCATATTTTTGCTTGCAAATATTAGTAGTAGTAGTACACATAATTATTATACAGTATCAGCACTCGATAAATAATCACAATTCTATTACTATTGTAT
CAGCACTCGATAAATAATCACAATTCTATTACTATTGATAATAATGTGAATACTATATAATAAGATTATTGTGGCTTACACCCCTGCACCCCACACTGCC
CCCGGGAAAAAGTATCATCTTCCTTTGTATTTGTGCGCGTAGTGTGCGACGTTAAGATATTATGTGAACTTTCCAACAATATACGTTGTGTACATCAAAC
AAAATGAAAACCGCGTTTGTGATTAAGTTGGCGCGGATGCACATGTCTAAGCAAGGACACGAAACACGAAGGAATACCGACCTACACTATGTACACGATG
GGATAGAAGAGCAACACGAAGCACGGAAGGCCATGAACGATGATAGGATTCTTAGCCGATGCAAACCACGAAGTTTTATGAAAGATGAAAGAGCACGCAG
CCATGAAAAGAACAAATGGACAGAACATGACAGGAACGTACGGGCCACGGAAGGGAACTAAATACATAGACACCCCAGCATGCTGAAAAGCACGGGCTAC
GGAAGAGCACGGACGCTCGAAGCCACTGTAGAACACGTACCGGTGAGAGTGCGCAGAAACAATTCTCTAACAACACCGGGTAAACATGGAGCACAGTCAA
CCGACCAAACCTGAGCCCACAGTAAGCCAGATACGGAAAATCAGAAATCATCAGTCTTGGGAGCACGATGCCTACGTAGAAACTGAGCTCACCGATCCAC
GGAGCGCGACACTACGGTAGCTAACGATAAGACAGACGACAGCCCAGCCCCGAAACCAGAAATAACACGGCAGCATGGACGGTGGGCTAGCCACTAAACC
ATCGGAGAACACGCTGCCACGCGAAATCACCGAGTCACGGAGCACCATACCAGTGTCGAGCTTTAGCTTACCGAGCCACGGAGGACAGCAGTACATAAGA
ACACGATTGCACGGACTGCGGACCGCCCACCAAATGCACAGGGGGTGGGATGACCACGATTACACACCGTGGAGCACGATGGCATCGTAGAGCACGATAA
CACGGACAACGCAGATGCACTACACGTGCACAATACCATAGACAGCATAACCACACCGTGATTGCACGATAGCGTGATACCGCGGTCGATGACACTTCAT
CAGGAGATCACGATGCACGGGCGATGGAACCACACGACTGCATGGAGGCACCAAAGCACGGAATAGCACCCTTTGGTTAGAGTACCGGCGATGGGAGGCC
AACGGCCACGAATGCCTATGTATCACGAAAGCGGTACAGCCCGCGTACATGTTTGAGAACAGGGAATAGTTAGGAGCCACGAAAGAGAGAAACCAAGAAG
TACACGGAAGAGCACAGGCCATTGAAGAACACGACATTCAACCTGTAGTACGGGGTAACGAAAACGTACCAAACCACGATATTGTACAAAGCCACATGAG
ATTACGGACAGCTAAGTGGTTAGCTCCACGAAGCCACGACGTACTAGGTTGAACGACGCCCACAAAACACGCGACACCAAGAAGCACTAAATTTGCGGCC
ACCTCATGTCCAACAAACCATGCCACTCCGCCGCGTAGCGGCGGCGAACGGTTAGTCTTACCTCTCTAGTGGAGTGTGTTGTCTGTCCGTCTGTCAGTCC
GTCCGAGGGTAGGGTTCTAAAATGTAACGCTAATACGTGGCTGCCGAGCGCAGCGAAGGCGGCCTCGATTCGCTTAAAAGCTGTCGTGCGCAGCGAAGGC
GGCCCCAATTGGCTAAAATCGACATTGTGTTTTGTACACACTGTATGTGGACTGCACATCGTACTTAAAAGCACCGCTTAAATTTCATTTTACTCTCCTT
TTCAGCTGTGGTTTGCAAGGCCACGCTATGGGCGCTGCCTGTCTGCGCGTTAGTTAGCATAATTAAAAGGCGCCGATGAGCACACACGTTCTCTATCGCC
GTAGGAGCTGTTGAAAAGAATTATAGACTTTGGTGACTTATATTTCGGCCTCAATCGAAACTTTAGTACTTATTGGATATATAATGATGTTTTAGGCTTC
GTAGTACTGCTGTACTAATTTAACTTACAACATTATTTTTCTTAGTACTATTATCAAGGCATTCCATATTTTTGCTTGCAGTTATTTGTAGTAGTAGTAC
ACATAATTGCTATATCAACGTTTGATAATAAAAAACAATTGTATTACTGTTAATAATAATGTGAAAACTTTAAATACGACTATTGTGGCTTGCCTCCGGG
TAAAAGTGTCACCTTCCTTTGTATTTGCGTACGTAGTGTGCGACCTTAAGATATTGTGCGAGTTTTCCAACAATATATGTAGCGTACATCAAACAAAATG
GGAACAACTATTGTGTTTAAGTTAGCGCGGAGGTACGTGACTCAGCAAGAACACGAAACACGAAGGAGCACCGACCCACGCTACGTAGATGATGGGATAG
AAGAGCAACACGAAGCACGGAAGGCAACGGACGATGATAGAAGACTTAGCCCATGCAAACCACGAAGTATTTTACGTAGCGTGAAAGATAGAAGTGCACG
CAGCCATGAAAAGGACAGAAGGACAAGAATATGACGGGAGCGTACGGGCCACAGAAGGGAACTAAATACATAGACACCCCAGCATGCTGAAAAGCACGGG
CTACGAAAGAGCATGCACGCTTGAAGCCACGATAGAACACGTAGCGGTAAGAGTGCACGGACAAAAATTCTCACGTAGCACCACGGTTAAACACACGGAG
CACAGTCGACCGACCAAACATGAAGCCGCGGAAGACCATAAGAGGAAGATCATCCGAGCATTATAGCACGATATTAGGGTAGAACCGGAGCTCCATGAGT
CCGACAGCACGATACTACGGAAGCTAAGGATCGCACAGACGACCGACCAACCGCGACACCACAAGATAACACGGTAGCATGAAAGGTGCCACTAAACCAT
GGGAGAACTCAGCTGCCGATCTGTAGACGGGAAATCACCGAGCCGCGGAGAGCGACACCAGTGTAGAACCTGAGCTCCCCAAGCCACGGAGGACGATACT
ACATTTGAACCTGACTGCACAGACGGCAGACCAGCCACGAGACTACGAAGAACACACTAGCATGGACGGTGGCCCAACCACCTAACCATGGAAAGCCAAG
CAGTTATGGGAGCTATAGACCGGAGATCATCGAGCCACGGAACACCATACCAGTGTACAGCCTGAGCTTACCGAGCCACGAATGACAGTATTACATGAGA
ACACGATTACATCGCTCGACCAGCCACCAAATGCACAGGGGGTGGGCTCGGTATGACCACGATTCCACATTGTGGAGTACGATGCCATTGCAAAACACGA
TAGCACGGGCAACGCAGGTGCACTACGCGAGCACAGTACCATAGACAGCATTACCACACTGCGATTGCACGATAGCGTGATACTGCGGTCGATAAAACCT
CGCCAGGAGAGCACGATACACGGGAGATGGAACAATACGACTGCGTGAATGCGCCAAACCACGGAATAGCACTCTTAGGCCAGAATACCAGCGATGGGAG
GCCAACGGCCATGAAAGAGGCCGTACTAAAGAGTATGAGTCCAAAAGAGAGGTCGTATAACCCCTAAGCAGCGTGGACCACGGGTGAGCAGGAAACAACG
AAGCCAGGAAGATCACGGAAGAGCGCCACGCCACTGTAGAACATGACATCCAACCTGTAGTACGGGGTAACGGAAGCGTACCAAACAACGATAGTATACG
GGTTCAGATGAGACTACCGAATGGTAATTAGTTAAGTACACGAAGCCAAGACCTACTCGGGCGAACGACGCTCTCAAAACACGCGACACCAAGAAGCACT
AAAGTTGCGGGCACCTCATCTACAACAAACCATGCCACTCCGCCGCGTAGCGGCGACGAACGGCTAGTCTTACCCCTCTACTGGAGTGTGGTCTGCGTCA
GTCCGTCAGTCCGTCCGAGGGTAGGGTTCTAAAATGGAACGCAAATGCGAGCGTTCTACTGGCTCCCGGGCGCAGCGAAGGCGGCCTCGATTCGCTAAAA
AGCTGTCGTGCGCAGCGAAGGCGGCCCCAATTGGCTAAAATCGACATTGTGTTTTGTACACACTGTATGTGGACTGCACATCGTACTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGGGAAATTAG
TTAGCATCCACGGAAAGGAGGGTCATACTACTGAAAGAGGCATGAGCCCCAAGAGAAGAGGGTCTCATAACTTCCCAAGCATCCATGGATCCACGGTGTA
GCAGGAACCACGATGCCGGGAAGATCACATAAGGATCCGCAGGCCATTGAAGAACATGACTACAAACCGTAGTACGGATAAACCGAAATGTACCAAACCA
CGATATTATACGGGGCCGAAATGAGACTACGGAAAGGCAAGTGGTTTAATACACGATGCCAAGATCTACGGGGTGAGCCACGCTCTCAAAACACGCGACA
CCAAGAAGCAATAAAGTTCCGGCCACCTCATCTCCAACAAACCATGCCACTCCGCCGCGTAGCGGCGGCGAACGGCTAGTCTTACCCCTCTAGTGGAGTC
TGGTGTCTGTCCGTCCGTCAGTCCGTCCGTAACGGGCTAGGGTTAATAATCCTCACGCTAATATGCGCGTTCTACTGGCTGCCGAGCTCAGCGCAGGCGG
CGTCGATTGGCTAGAATCGAATTATGTGGTGCACACACTGTATGTGGTCAACACATCGTACTTCCAATGTACCGCTCAAATTATATTTTGCTTTTATTTT
CAGCTGCGGTATGCAAGGCCACGCGAAGGGCGCTGCCTGTGTACGCGTTAGTTAGCTGAATTAAAAGGCGCCGATGAGAACACACGTTCTCTATCGTCGT
AGGTGATCTTGATAAAATTTGTAGGCTTCGCTGACTCATACTTCGGCCTCAATCAAAACATTAGTACTTATTGGTTTAAATATGATTTGATTTGCTTCGT
AGTAGGTTTTTAATAATTTAACTTACAGTACTGTTTTGCGTAGTACTATTCTTAAGACATTTCATATTTTTGCTTGCAGTTATTTGTAGTAGTAGACCAC
ATAATTATTATGTTAACGTTTATAATAAATCACACCTCTACTACTACTATTAATAATTGATACTTTAGGATGTGAAAACTTTAAAATATGACTATTATGA
CTTCCCACCCGACACCCCCCTGCACCCCACACTGCCCCCAGGAAAAGTATCATCTTCCTCTGTATTTGCACACGACCTTAAGATATTGTGTGATCTTTCC
AACAATATATGTTGTGTACATCAAACAAAATCGGAACAGCGTTTGTGATCAAGTTTGCGCGGAGGCACGCGACTCAGCAAGAACACGAAAAACGATGGGA
TAGAAGAGCAACACGAAGCACGGAACGTCATGGACGATGATAGAAGATTTAGCCGATGCAAACCACGAAGTGTTTTACGTAGCGTGAAAGATGGAAGTGC
ACGCAGCCATGGAAAGAACAGAAGAACGAGAATATGACGGGAGCGTACGGGCCACGGAAGGGAACTAAATACATAGACACCCCAGCATGCTGAAATGCAC
GGCTACGGAAGAGCACGCAACTTCGAAGCCACTGTAGAGCACGTAGCGGTAAGAGTGCACGGACAGTAATTCTCCCATAGCACCACGGTACAACACGGAG
CACAGTCGACCGACCAAACGTGAAAACGCGATGTACCATAAACGGAAGATCATCCGAGCATTGGAGCCCGATATTAGGGTAGAATCGGAGCTCACCGAGT
CCGACAGCACGACACTACGGTAGCTAACGATCTCACGGACGACAGACCAACCGCAACATCGCAAGCTAACACGATAGCATGGACTGTGCCACTAAGCCAT
AGGGGAGCACAGCCACAGGAGCTATAGACGGGAGATCTTTGAGCCACGGAGCACGATACCAGCGTAGAAGCTCAGCCCCCCGAGCCACGGAGGACAGTAG
CACATTAAAACTCGATTGCACGGACGGCAGACCAGCCACGAAAATCACGGGGGTGCTTTGGGGTGACCACGATTGCACACCGTGGCAGCACGAAGCCCAT
GTAGAGCACGATAACACGGCAACGCAGATGCACTACGCGAGCACAATACCATAAATACCATTACCACCCCCGTGATTGCACGATAGCGTGATTCCGCGGT
CGATGACACTTCATCAGGAGATCACGATGCACGGGTGACGGAACCACACGACTGCATGGAGGCACCAAAGCACGGAATAGCACCCTTTGGTTAGAGCACC
GGCGATGGAAGGCCAATGGTAACGAAATAGTATCTACCACGAAGCCAGTGCAACCCACGTAAACGTTTGAGAGCGGAAAACAGTTAGCTTTAACGAAAAG
ACCGTACTAAAGAGCATGAACCCACAAGAGAGAGGACAGA