Description :
From Genome Similarity Track
Location :
Scaffold_124:6309- 10070
Transcript NameFunction/comments
Phyag_g2404hypothetical protein PHYSODRAFT_351210
Phyag_g2405hypothetical protein PHYSODRAFT_560133

Sequence
3761 bases(100 bases per row)
TTACCCGTACCAGCTTAACTTGTAAGTTATTTCTCGACTCAACAAAACTACACCATGACCGTGGAGTTATGCCTGGTCCGCGAACGTCACCGTCCGTTGC
TCGTGTTGGCGCTTGGCCTTCGATAAcatcatcaccagcatcagCGCTGCTACATGAGCCGCTAGCAACCCTCCGTACCAAAGTGGCGCCCACGGGGTAT
CTAGCTCCAAGAACGGATACGGCCAAAACCCCTTTGCCACCGTCCCATGCACAATCCATGCAAAGACCGCGTACACCGATGGCCAGCCCATAACCAGCGG
CAAGGCATCTCTCGACACCAAGTGTCTCGAAGCAAAGAAGTcaacttgcagcaacactACATTGACCCCATGTTGGCAATAGCTCACTCCATTCAAGATC
TTCTCCGGATGGCCACTTTTGACAGCGTACGGATACAAGATCGTCCACACCACAGTGGAGATGAGCAGGGAAGCAGCAAGACAAACATCCAATAGCAGCT
CCAGGTCGATCCAATGCAGCCCGCTGTCTCTGATCACCCTCCTCCGTCTGTTGAAGCTATCATCGTCTCCGTCCCTTAACGCCATGTAACTCGCCGTCAT
CTCGTCCATTCGACGTTGCAATTGGCGTCTGGTGCGCCACGCGGCCCCAATAAAGTACGCGCCTTGCAGGATGAAGTTCCACGACGTGtagaaggccaag
cagcggCCTGCGGACCGCCACACGTCCCAGATCTGgaccaagacgaagaacgTTGCGCATCCCGCTCTGTACGCTAATAAACCGCGCAGCGACCAGCAAC
TTCGcgggtgcagcagcgcagaagGTTCGCTAGACAGAGGAACGCGGTCCAAGCGCCCAGAACGACGCGTAACCAGCCAGAAAGACGTGCACAAAGtcgc
caccaactcggccgccaccaccagcgttGACCATTCCTCAAGCTTTTGATGCATTGTTCTTTTGAATactgattggctgaaatttTTTAggaacaagttg
aagttgccggGTTCTAATGTCTTTGACGAATCCTGCTGATGATGCAAGGAGCACTTCGAAGTGAATAAGCAAATACTTGTACTGGTGTTCTTGTCATTGT
GCAATTTGCCACGAAGCAGTCGACGAGGGCGAAGGATGGCGGGTATTTTGtacgtggcggtggtgtcgcGCATGATGGATTGGAGAGACGCAGCGCTCCA
TTTGCTGCCGAGTTACCTGCGTGGGGGAtcaccacgacgcagcatctACACGCCGAAGGAAGAATCGAGTGGTGTTGTCTACAATGCAGCACCGACGTCG
CGTCATGCGGCACCCACACCTCATTTCAGTGGTATTGCAGCTGACACGCCACGAGTCCCGAACTGGAGAGTCAAGAGCAGAAGCAACATCGCAATGTAGC
GCAAggtgttgatgttgttgtaATATTCACAGGAAAGTCGATGTCCATTTCCGGATGACTGCTACAAGTTTCGTTGCTTCCAATGCATTCTTTGAGTTTC
CCAGTAGTTTGAGAACTTCTTCGCATCGATGTGACAGTGCTCCGCCACTTTCGTTCTCTTGTCCGGTAGCAACTAGGCGAAAAAATCCCATACAAGCGCC
ACGTTTGCCTTCCCAGTACTCTGGATCCGGGTCGAGTCTCTCCAAAACGTCGAAAGCCTTTGCCGCATAGTAGAATTGCTGAGCTTTGTAGCAGTCGTTA
GCGATCTGCTTGAGCAGAGCGAACGCTGTCTGCGAGTTCTCTATCTTGAGATAAACTCCCCACGCCTGCGATGCGCGACCATTGTTGACGTAGCAACGTG
AAAGCCACCCACAGAGCACAAACTGTGACCGCAGCGCCGGGTTCTGTACTCGCAGTAAAacctcttcagcttcacgaTAACTTCCTGAAGCTGCAAGAGA
GATCCCGTAATTCCAGTTGAACGCATCATCGGAACTCAAATACGTCTCGATCGAGCTCAGGTACACGTTAACGTCATTGAATTCCTTGCGTAGCATGAAA
TATGACGCCATGCATTGACGACCTGGAATCGTGTCACAGTCGTCAGGGGACGACCCGGCAGCGTGAAAGTACTTTTCAGCGAGGAAAATGTGCTCCTTGG
AGTGCGTCTGCTCCCCGATGACAGCATGCAGCACTCCCTTTATCGCGCGTTCGGGTGTTGTGTTGGGTTCCTGATCTTCCACCAAGGCGAACGCTTTATG
ATACTCACGACGCTTGAGATGCAGCAAGACCAGATTCAGTTGAGCTTCGTCGAGATGGCCTACCAAAGGGCTCAGAACTCTCTCAGCCGCTGCACCATGT
TTCTCAATGCCGTTCGACTCGCGATCTGAAGCTCGGAAGATGGCTAAGTTGTGCTGCATCACGTCCGCCATTGCTGATTCCGAATGTGTCGAGTTCGCTG
TAGACGAGTGAAGTGCGTCGAAAGCACCTTGAGCGCACGGATGGCTGGGAAAGTGTCGTAGATAGTCGTCGAGGATAGACTTGGCCTCACGTGCGCTGTA
CAGGCGAAAATTACAGCTCGCTTTCATATTCGtcgcgaagaagctgtccGGATGGCCAACAAGATAGACCGCCAACAGTTCCAGTGCGACATCATCGTAG
CCCAGCCTGAAGTAACATAGCGCTAGATACACATGAAGTGCTGAGCCATCATCTTGATTCCCCTTGGTCGACTCCGCAAGCAGTCTCTTGTAAatctctg
ctgcttcttggaaATTATTCTGCTCgaagcttgttgctgccagAGCAAGTTGATCCTCGACTGATTCCCGAGAAAGCTGCTGATATCGATCCATTAACGC
TTGCTCgccatgatgtcgtcgattTGCAAGGAGAAACAAGAGCCGATTGCAGAGAGCACTTCGAGAACTGCTCAACGCTGCATGTTCAGCATCCTCGAAA
TTTTGCAGATAGAATAAACAGCAAGCGCGGCTCAGTCTCCAACTCTTCAAATCTGTAGCTGTGGCGCCGCCATTCGAAGCGGCACcaatgagctgctcga
actgGAGTAATGCTTCTCCGTAGTTCCCGCTGTGAAAATGGCAATACGCCACCCACCACGTGTTCAGACACCACGACCGGAGATCGCTGTTTTCTAGGGC
ACCTTTCTTCGATCGAATCGATTCTtgttctccgtcttgccgcCGTATAACCCTCAGCAGTGTCAGTGCACCAACAAAATCTCCCCGGTCGAGGTAAGTA
TCCAACTCAAACACTGTGTCGCGAGGAGGCTTCTTCCTTGTTCGCTGCTGAGTATTGTCCTGTGATGCCTTGGTTTGCTTTGACTGCCTCGCCACAAACA
TGCTGCTAGTCTATCCTGCACTCGGGTTCAAAGCGACTGCTGGAAATACGATCAAAAGTCATGCGGTATCTACATTTGAACTTAAAGCGTCCCTGGTTTC
ACTCGCTGGTCTTTgtctcttcctcttcgacaTCACCTTGTTGTTCCTTGCTTTCTTGGCCCACCTCCGTTGGCGGTCGATAGCTTTTCGATTCAGACAG
AGTGTCAGGTCTATTGCTGGTATCCGCTGATGTATTATGCGCCCCGTAAATGTTGAACAACCCTTGAGAGGCATCGCCACTTTTGCTCTCTTGATCAAGT
GTCAGCGATAAATCACCAGGTGAAGGTTCCGAATGCTCGTTGGAGGCACCCGACAGATTCCCATGGCGTCGACTAGGTAGATGCCCAGAGTCGATTGAGT
CTTGCGACTGACTTGATCCTGACAGCAGCATTGATTGCTCTGATACAATGGCATCGGCAAT