Description :
From Genome Similarity Track
Location :
scaffold_142:6308- 8099
Transcript NameFunction/comments
Pl_108849hypothetical protein PHYSODRAFT_321395

Sequence
1791 bases(100 bases per row)
GGCCTTCCGGTCGTTGATAGAGCCCTGTATCCAGAGACTTAATGCTCTCGTGTCACACAAGAACTGTCCCCGTGACTACATGTACTACAACACACCGTGC
CCATGGTTGCAGGTCAAGTTGCTGCGTATCTTGCAGCAGTTTCATGCGAATGGCGCGTTGGACGCCGACTCAGCTGATGGAAGACTCAACAATATGCTAA
ATGACACGTTGAGCCGCGTTTTGGCGCGCACACCACCCGGTAAAAGTGCCAAGAACAACGCAGCCTACGCCGTGCTGATTGAAGCTGTGAACCTCGTCAT
TGCACGAGGCAAACCGGGTAGTGATACTGACAGCCCAGCGTACAAGTTGCGTGAACAGGCTGTAGCTCTGCTGGCTCGCTTCATTTCCGTCACCGAGCCC
AATATTCGCTACGTCGGTCTGGATTCAATGTACCGCATGGTGCGGCTGGATGGTGACGGCACTAGTGTGAAGCAACATCAGGAGACTGTGCTCTTCTCAC
TCAAAGATGCCGATCCATCTGTCCGTCGCCGCGCGCTGGACTTGCTGTTCGCCATGTGTGACTCAACTAACGCTCAAGAAATTGTGGGTGAGCTCGTCAA
CTATTTGGCCGTTGCAGAACGCACTGTGAGCACCGTTCCAACTGCAGGACCTGTTAGTGGCATTCGTGAGGAAATTGTGCTCAAGGCTGCCATTTTGGCG
GAGAAGTATGCGCGCGACTTGCGCTGGTATGTGGATACGGTGCTTCAGCTTTTAACCATTGCCGGTAGTGAAGTGCCTGACGCCGTCTGGCACCGCGTGG
TGCAGATCGTGACGAACCGCGAGGAGCTACAACGGTATGCTGCTGAGCAAATGTTTAAGGCAATGGAGCCTCGCTACGTGGATGAGACTACAACCAAGTT
TGGTGCGTACGTGCTAGGCGAGTTTGGGTATCTCCTGTGTGATGATGCTTCCATGAGCGACACGCGTCAGTTCGAGGTGCTTCATCAACACTACGCGGAT
TCCAGTGTGCCCACAAAGGGAGTGCTTCTCACGGCTTTTGTCAAAATGGACAATTTGTACGAGGAACTACGCACAACTGTACACGGTGTGCTTGCCAAGG
CCGCCAGCAACATGAATCTGGAGATCCAACAACGCGCTTGCGAGTATTTGGCGCTACGTCAATTGTGCCAGAACTCGCCAAATGGTGATGAAGTGCTGCG
AGCTGTCTTGGAACCCATGCCGGTATTCCCAGAAAACCGTGAATCTGGACTCATTGTTCGCCTTCGCAACCAGCAAAAGGCTGCAGCCTCCGTCGGCGAT
GGCTCTGTTGTACCGGACGAAGGACCAATTTCCCCTCGTTCTCAGGCGCGCATAAGCGAACAGCAACCAGCGATGGACGGTGCGGTTGACTTACTGTCTT
TGGATGAGCCTGTGGCCCCAAAGACTTCATCAGCCTTTGGCTTGGGGGCTGACCAGGATGCTCTCCGAGGACCCAACCCAGCGTCAGCGGACTTGGGCGA
CATTTTCGGTGGAGGTGGCTTTAGCGGTGGCAAGCCGGTGGGTTTGGATGCCTCGTTGGCGCCGCAGATTGCTGTTTGGGCGCGTAACCTCATATTAAAC
CCGCAAGGTGTGCTGATTGAGAACGACGTGCTACAGATTGGCGCCAAGCACGAGTATCGTGGTTCACAGGGCCGAATCAATCTGTTCTACGGCAACAAAA
CCACTGACACCCTGAATGGCTTCGCGGTGCAGCTTGCAACAGGCAACTTCTTCCGTGTTCAAGCTGAGGAAGTGCCAACTCAGCTGGCAGG