Description :
From Genome Similarity Track
Location :
contig_104:63076- 66005
Transcript NameFunction/comments
g13041.t1ETP09239.1 hypothetical protein F441_14891, partial [Phytophthora parasitica CJ01A1

Sequence
2929 bases(100 bases per row)
CGACACGAATCCTGCTCGAAGACCGATGCAGCTACGCTTTGTGTGTTGTGAGCTTTCTCCGGAAGAGTGGGCAGCGCTGAAGCAGTTGGCACGACTTCTG
GATCCTATTGAGGGACTAGTGCACGTCTCGCCGCTCGCTTATCCTGGCCTGTCGATCGTGTATCCGCTCTTGCACTCTTTGAAAAAGCATTTAGCGGATG
CGGGGGCGTGGGTGACTGATCCGCTTGTCGCGACAGTTCGTCATACTATCGTCGGCAACCTTAACATGGATCTCTGCTCATCAGGACAAGCTCCATCGTC
GCCGTATTTATCGTGTCTACTAGACCCACGCTTCAAGTCACTGCCGTTTTTGCCAGCACCAGAGAAGGAACGACTCATCGAGGCACTTTACTTGCTTCTC
GGCGTGAATGACAAGGACGATGAAGGCGTCGATGATGGTCAGCACCAGCACGACTCATCTACTGAAGACGATCAAAGCGACGAGCAGAAAAACAAGACGG
AACGCCAAAGGTTCGACTGCATCGGCAACAAGCGCCTCTCTTGCCAACAAGAAGGCAGCAGCTCTGTTGCACGAGTTCTTCCCGCTTGACGAGCCTGCCA
CCGAGCTCGACAAGTTAAAGGCTCAGGTGCAGCAATTTCTGGACTCGCCGTCTCTGCCGGCTACAGATGAGACCGAGCACGACCCGCTGGAGTGGTGGAG
TCGCTATCAGCGACTTTTCCCGTCGCTAGCGCGACTCGCCAAGAAGTATCTGTGCATTAGTGCCGTGTCAACGCCGTTCCAAGAAGCGTTTACAAACTAT
GGCCAACTGATGCGAGAGAAGAAGGCTCGACTGGACATTGAAGTGGCAGCTCAGGTGCTTTTCTGTCGAAGTGTTTCTCGTATCCCAGAGATGGAGCGCA
TCGGAGTTTGAGAACGGAGGACGATGAAGAAGATGTTGTCGAAGGTGATTATCGTGTTTATTCGTGTGGCCTTTCAAATTATTCGCTTTACTCCCATGGA
TCAGCTTGTTCGAGGTTTGGCATGAGGTTAGCGTCGTTCATTGGCGCCTCGTTGGCGTTGAAGTCCACAGTTTCCAGCCCCGAGCGTACGCCGTCCGTCA
GATCGTCCCACATGACTAATTGATGTTCTTCAGGTAGTGGCTAGAGCCAAACTTCACAGTGTATTCAAGCTTGAAGCGAGTCCCGTTCAGCACTTGAGGA
GCAGGAGGTACGCACGTCCGGTACCGATTGGATGCCTCCGTTATCGCCACGCCCATTACTGTCGAGCTCGTGGAGGGGTTGCCCAGCCATACAATAGCAT
GCTCCCAGCCACGGCGATGGCCAAAGTAAGACGGGATCTTCGTCCGGTCTCTCGGAAAGTATTACGCGTACATGACGGCCCATTTGTCGCTCAGCTCCGT
CGAGCGGCCGTAAACCTGGGGCCCGAGAGGAGAGCTCGAACACTCGTAGGATGTACCCACCGTAACCGCGCTCAGCCCTTCATTGGTGTTGGCATCTTTA
TCGACGGCAGGGAACGGCATACAGCCGTCCGTAATGGACAGGTCTCCTGGTCTGGGGCTCACTTGTTAATCCTCTCCGCCAGTCACAAGCTCACCTCTAC
CTTTCAAGCGCCAGCAATGAACATCGGGCGATTCTTTATCGTTGTGACTGTCGCGCTCTTCTCCATCAAGGCCGACTCCATTGACCACGATAAAGTACAA
CCGTTTCCTCAGCCGCAACCTGTTACCATCTCCGAAAAAGCTGGTGTCAAATTCAAGCCGAAACTCTTTATCCAAGAAGGGTGCGTCTCGTACCCCGCCG
TGAACGCTGCCGGCGAGCCCAGCGGAGGGCTGAAAGGAACCGGGGATGATTCCGGCTGTAAGCTTCCTTCATTGGGCTCACAGGTCTACGGCCGTGCCGA
ATGGTACAACGACGTCTGGGCCATCATGTACGCCTGGTACTTCCCCAAGGGATTCTGGGATAAATGTCCCTATTGGCGTCATGACTGGTCAAATGTTGTT
GTGTGGATCGACAACCCGGACGTTGAGACCTCCAAAGTGTTGGGGCTATCCCTATCGACGTCCGAGAACAAGTATGGCCACAAATATGCACCTGCAGAGT
CCATTAGAAATGGCACAACGCCGATGCTGTATCGCTATCTTCCATCCTTCGGCAGCGCTGGGCTAAACACCTATGTCGATTTGGGCCAGTTCCAGGATTT
GATCATGTGGGATCAGCTCACAGACGCAGCTCGTGCCGCACTCAACGACCAGGACAATTTTGGCCGCACCGAAGTACCGATAAGCGACGATCACTTCCCC
GAGCATCTCGAAAAAGCGTGGCCGTTTTAGTTGCCATGGCGAGACGAAGCTTCTGATGGGAGCGTGATGGCATGGCTCGCGCGGGGTTGTCCCGTACGCG
CTATTCCGATGCTGACATTCGCCATAACTTTCCCCTATGCAAGAAGTTCTTCCGTTTTTCAGTGAGGTACATTGATGTCACTTAGTTGTGCTAACGACTT
CCTATGTCCGTTCTAACCATCGCCCCTATGTCGGTAGTTAGCCTTCTCCAGGTCCTAGCTTACGCTTCCCCGTTACGTGTCGGTGTCCTTACTGACTGTC
GGCCACGACGTCCGCTTGCGCCGCGTTGTCCTCGTGTGTTTTCCATTGTATCATGTCTCCATCTAGGTGGCGGAGTACTTTCCTCCATTTCCCTGAATCG
GTGCCCGTGTCAGCCGTGTACTGTTGTACGCTCGTTCTGCTTTCGAGCGCTGTGTTTGTTAGCTCCATTGCCATACGGTTGGCTTCTTTGTCGTGGTGTA
GCCATTCTACTTCCCGGAGCCGATCCACGATGCGCCGACTCCTCCAGTAGATTTGTGTTAAATGCCGTGCCTTTGGGGGCTTGCGTTGCCGATGCTGTGC
AATCAGCATCTTGTTCGTGCTCACCACCC