Description :
From Genome Similarity Track
Location :
contig_120:63076- 64531
Transcript NameFunction/comments
g13939.t1XP_009533075.1 hypothetical protein PHYSODRAFT_517932 [Phytophthora sojae

Sequence
1455 bases(100 bases per row)
GCTTTCTTCACGATGGAGGACGCCAAGGCGGCCTTCAATCTCTTCTGCTGCGTCTACGGCATTGGAACGCTTGGTATGCCCGGCAACTTCTCTCGTGCCG
GCCCCGTGCTTGCCGTCATCGCCATGGGTTTTATGGCCTTCGCCAACGTCTACGGCGCGGTGGCTATCTGTCGCGTCATGTTGCTCGCTCCCCGTTCCGT
CAAGACCTACGGCGACCTGGGTCAGTGGGCCATGGGCAAGCCGGGCCGCTACCTCTCGGTCGTCTCGCAGATGGCCAACTGCCTGCTCGTCCCTTGCGTC
TTCCTCGTGCTCGGCGGTCAGCTACTGGACGGCCTCTTCCCGGGAGCCTTCAGTACGACGACGTGGATCATCCTCATGGCGCTTACGTGTCTGCCGGTGT
GTCTGGTGCCAACTCTCAAGGAGGGAGCTGGTGCTGCTTTCGCCGGTTGCCTGGGCACCATCATCACGGACGTCATCGGCGTCGCAGTTGTCATGTACGG
CATGCGTGGCCACCCGACCATCCCGAAGCCCGACCTCACCTTCAAGCAAGTGGCTGGTGCTTTCGGCAACCTGGCGCTCGCGTACGGAGCCGGTATCGTG
ATTCCGGCGCTGCAGCGCCAGCACAGTGACCCCACGCGCATGCCCCGTGTTGTTGGTGTCACCATGACGTTCATCTCGTGCTGCTTCCTGGTTCTGGCTA
GTACTGCGTACTCGTCCGTCGGCTGCCAGATCTCGGGCAACTTGCTGTGGTCGATCTACCCGGACACGGAGACTGGCCTGACCACGCTGGCTTCGCGTCC
GACTGGGGTGCCGTCGTCCTCGCGTACCTCTTCATGCAGCTCCACATTACGATCGCCTTCTCTGTCATCCTGAACCCGGCCTTCTACATCGCGGAACGTA
TTATCCTTGGCATGCACAAGCCCATCGTCGATGACGTCGAGAACAACCTTCTGAACTATGCCGATGCTGCTACACCCGCTGATGTCGAGCGCTCGGAGAA
GCAGTCGCACGTGTCACGTGCCTCCAAGCGTCGCTCCTTCATCTCCGTTGCCGACAACGAGAACGTGCACCTCGGCGACGACGAGGCCGAGGCTGCCGAG
TACCGCGGCGCGAATGCCATCAAGTACGTGGTTCTGCGGATCATCATGATCGCACTCTTGGTGGTCGCATCGGTGCTCCTGAAGGACCACTTCCACGACC
TGGCCGATTTCGCGGGTGCGTCGTGTATCACGGTGAACTCGATCCTCTTGCCGATTGTTTTCCTGCTGAAGAAGAGGTGGAACGTGCTACCGATGTGGGA
GAAGATCCCGGCGCTTATCGTGATCGTGGTGTGCTTCTGTCTGGGCTGCTACGTAACGTATACGTCGGGCAAGAACCTATTTGCTCCTACCGAGGATGAC
AGGGACTTCCCGTTTTGTGCGCCCGAGTTCGAGAATACTGTCTACTACAACTACA