Description :
From Genome Similarity Track
Location :
Scaffold_58:63066- 68345
Sequence
5279 bases(100 bases per row)
CCCGTACTGATAGTACGGCCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACGTGGCAGTTCAATCATATATGCGTTGCCGAGGTGGCGC
AGCACACGAATTGGACCGATGAACTTGGGTAGTAACTTGTTACTTCCTACGTTAGTCACTATGTGTCGAGGTAGGTTTACCGTAAATAGTAGGACTAAGT
CGCCTTTATTGAATAAAAGAATATTTGCCCTTCCATTCTTGTCAGCGTTTCGTTTTTGTCAAACTACCGCCTCTTCGATAGAGTCTTGTACGAAACGGAC
AACCGTTTTGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTATTTAGCTGTGGTGCTCTTGGAGCGTACTGCAGCAAGATCACTTGTCGCCTCTGTG
AGTGTATCTTTGGACGCACTAGGCGTGATGCTGACTTGATCAGTATCGTGGCCAGTAAGAGCTTCTTCGCTCTTACTTTCGTCTTCTTCACCAAAGCCGA
TGTGATCGACATCGGCGTCGAAACTGGCGACCGGATTGTCAGCACGTGACGAATGAGAGCCGGATTGACGGTCGTTCGAATGAGCCCCCCCCCTAAACGA
GAGTCACACTCTATAAAGGTGAGAAGACGCGGACGGCGTAAGCCATTCACGAATAACGGCTTGTACGTCGTCGACGCATGGACTAAATTGATGATGGCGA
ACTCCACCATCGGCAGGATCTCGCTCCAAATCGTAAAGGAATGGACTTATCCTCGAAAGATCTCCTCGAGGACACAATTGGCCCGTTCGGTCTGACCAAC
TGGTTCAGGATGGTCAGAAGTGGCCATCTTCAAGCGCGTTCCGAGTGTTTTAACCATGGAACGCCAGGACTCAGCTGTGAACCGCGGGTACCTATCGGAC
ACGAGTTCACGAGGCAAACCATGAAGTCGAAATAACGCGTCGATAAAGACACGGGCACAAGCCTATGCGTTGACAGCAACCAGATGTACCATCTTACTGA
ACCTGTCAACGAACACAAGAATACCAGGATTCTTGTGAGACTCTGCGGGGAATCCAAAGGCGAAGTCCATTGAGACGGATTCCCAGAACTCGGCCGGGAC
GGGCAGAGGCTGCATCGGAGCTCGAAGGGAAGGGCTAGATTTTACCTGTTGACAGACCTCAAAGGCGCGAACGTACTAGCGCACGAACGGATACTGGCGG
GGCCAGTAAAAGTCGCGGCTCACTGTGTGATATGTTTTCTCACGAACACGATTTACACCAACAGGTGCGTCGTGGTACTCATACATGATACGCAATCGGA
GGTCAGCATGATTTGTACGACGACACGAGGCGTGTCACCGGCAACAGCCTAATATTAGAGTACGCCGTTGCGAACTGTATATCTATCCGTAGAGCATCGA
TATACTGACGACAACTGTTTGAGGCTATTTTTGGATGAGTACGAGAGATGATGCATCAATCGCACCATTTCCGAATCATACGCCTGTCGTATGTCTTCTA
ATAAGGTTGATGACGGGACACTCGAAGTCAGTACCACGACAGTGGTCGGACCAGTGTCGGGTGGCGCAGCCGGCTCGAAATTGGGCCGGCACGAGAGTAC
GTCAGCGATGACGTTAAGTCTTCCTGGATTATACTCGACGGAGAAGTTATACTCCGCAAAGAATGACAGCCACCTCGCCATCCGCTGCGAGAGGTGTGGA
CTGTTTACGGCCGTGCGTAAAGACGCATGGTCCGTATAAACGATGAAGGGTCTATCACCGAGCAGATCGTCTCTGAACTTAGCCAGCATGTACTTCATGG
CAAGGAGTTTCTTTTCATGGACGGGTTAGTTGCGTTCAGCTGGTTGCAGCTGGAGTGACTGGTAACAGACTATACGCTCCGCATCGTCTGCATCTTTCTG
CATTAATGCACAGCCGATTGCATAGTCGCTGGCATCGCAGACCACGTGGAATGGCCTGTCTTGGTCTACAATTGCCAAAACTGGCGATCGTATCAAGCTT
TGCTTGATACCTTCGGAAGAGCACTGGCAGTCGGCACTCCATTTCCACTTCTCTTTCTTTTTCAATAAATGAGAGAGATGAACAGTCATCTCGGCTTAAT
TGCGTGAATATTTATGCAAATACGCCGCTAGGCCAAGGAACTTCCGAATTCCCTTGACGTCTGTAGGCACCGGCCAGTCGGTGATCGCTCGATATTTTCC
GGATCGGGCTGGACGCCATGCTTACCCATGATGCAACCAAGAAGTGGTATTTCGCTAGCAGCAAACATACACTTTTTGATGTTGGCTTACACCTTATACT
TGCGCATAAGTGTAAGAACAGTTCGGACGTGTAGTCTGTGCACTTCCACATCTGTCTGTCCATCCATAGCCCAGATATGGACAAACAAATTATCGAAGTA
GCTGGGCGCAAATTTTCGTACAGATCTCAACAGATTTGTTACACATCTGTTGAATGTGGTAAAGGCTTTAACTAGCCCTTGTGGCATTACTATTCCTCCC
AAAAATACCGCCTGGGGTGCTCACTGCAGTATATGGGATGTATTTTTTGTGCATAAAGATCTGATAGCCATCTATCAGATCCATTGATGAAAAGATGGTA
CTCTTTGCTATACAATCTATAATAACACCTTTCCTTGGTATAGGCGTCTGAGCCGGTACCATTGCAGCATTCAGTTTGTTAAATGCATGCACTATCCGCC
ATCCTCTTGTGGCCTTTCGCACACAGAAGGTCGGAGAGCTATGAGGAGTGGTGGACTCCCTCACATGACCGGCTGCTAACGATCTACAAAGAATTTGTCG
ATCGCTAGTACTTGTTCACGAGGCAGTGGCCATTGCTTCATGACACAGTACTTCGAATCCGGGATCAGGGCGATTTTTGTGACGAGTACCTTTGTCCTTC
GGTAACTAGCACGGGACTGCTTCTGGGAATACATCCCTGAATTCCATTAAATCATCGTATAGAGGATTTTTTCTGAGCGACTTCCACAATTAAGATGTAT
ATCGATCAATTCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTACTTAGAACTCTTTCATCCTCGTCAAAGACCATTGCCGATCGGATATC
ACTGACGTACTTATCTTCCGCGACTAGTACGCAGATCTGCTATACTTTTCCACTACGCAGATTACGCAAGAACCTCTTTTGGTTCAGCAGGGGCAACTTA
GTGATCTCCAAAGTTAAATTCGGAGGCGCGATCAGATCAAGCATATGGCTACATATTTTTGATCCGTCATTAACCAGGACATTAATGTCTCTGTCATCTC
ATGGGAACTTACTTTCACTGTTTGTTGGGGAATTATTCCCTCAACTCTAGCCTCTTGGGCTATTCCATCTCCGTATTGACCATCATTGGCAATCAATTGG
TCGCGATCTGGGTGTTGTATATTAAGGAGGCAACCATGCCCCGGTCCGCTTGACTTATTCGAGTGGTGGGCCTTCGGCGCTTCTTGCGTTTCTATGAAAT
CGCCGGGAAACTGCTCCGCAATATGATGGTTAGTCACATTGTGATTTTTTGCAGTCTTACTAACGACCGAACCATACGTGAGGCCATCGCACTCACTCGT
AGTACACCAGATGGTGGCGGACGCTCCAAGACGCTCATCAGATGGGCATCTGGTGAACGAGCGGCGGGCATACCGACACTTCGTCGATGTCAGCTGAATT
GTGGATCATACCTTCTGAGCCACAATAAATCAAGACTAACATCAAATTTTTCATCCAAGATTAAGACGATGAAGCCATCATTGTATTGGAATTATTTTAG
TGTATAGGAAATTCCTACTATGCGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGACGTACCGTCATCCTCTTTAGAGGGATCTCTCGAGCGATTGGC
GTCGTACAAAGCTGTTTGACACCCCACAATCGACTAGGGCTCGTAGTGACACGTCCTTTGCCACTTCGAGCTTCAAGGTATTGAGGTAAATCTCATTACC
AGATGCAGTAACACACAATGATTGAATGTTGGGAGCAATTCTCGTCAAGAGGCCTGCAAATTCACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCT
ACTGACCCTGACCGTTTTTAGGTCGTACGTTACGGTGTTGCGTTTTCGCAACAGTGTAGGACCCACGCCTCGGACCCTTCCTGACCGCTTGACGGTTACT
GTTTCCTGCGGTACGTGGTACCGCGTTCGGGAAACTGCATTCGTATGCATAATGCCCTGACTTTTGACACCTATTGCATGTCTGCAATTTGTTATAATTT
GTAACGCAAGAGCTTTCACTCTCAGCGTAACAGAGATCCACCGGTTTTGGGCCTCCGCTTTCCTGTTGCCTCGGGGGACGATAGGAGTTTGACTCACGTG
ATCTTGTTTCACGCTAAAAATCTTCTTGTTACGCAACTCGAATTGTCTCTTCCACGGTATCAAATTCCAACAGGAAGAGATAGATCTGACGGGACCGTCT
GTGCGACCCTGCATGAACAATGTGATAAACGTTTGTTCATTCGGCGGATTGGACGTGATGCAACTCGTAAGATGACGTATGTACTGAATGTACGAGTGTA
CATCACGTTTGCCTTGTTTGAGTTTCAGGAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGTTGGCTCGAATGTTTGCCGAAGCAGGGACTTGTAGACTTC
TAACGACCCAAAGACAAATGGGTTGTGTAGCTTGAGGCTCAAGGCCCAAGTCTTCGCACGCCCTGCCAAGTTCGACTGAGCAAATGCGACCTGCATTTGC
TCATCGACGATGTGACGAGCCCTTATGGCGTCATCTAGCTCAACTAAACATCTCAGTAGAGAATCTTCTTCAGCTGCTTTGTATATGGAGATGTCAATCT
TTAGTGATTCGGGTCGTCGTTCGCGTTTCGACCCGGTAGCAACAACCTGCTGCTATCTCAACAGCTCTGTCTGTTGAAACCCTTGTTGGTGAAGTAAGGC
TATCTTTCCCGTTCAGCATCAAGTACATTCTGAATGAACTTGGCGATGGTGGCGTGTTTCCCTTCTGGACCCAGAGCGGATAGCATTGCGTCTACGGCTT
CTTGACCCATCGTCGAAATCAAGCGTTCGACAGCGTCCCATTCGATTTGACTCAAATGGGAGTGGCTCTCGTGCGTTGGATGGAAGTCTTCCGCTTCATC
ATCCAAAATGTTCATAGTCGTTGGACGGACTACAAAGTGCTACCACGAGTAACGGGGCACCGATCGCTTGTACTTTCAC