Description :
From Genome Similarity Track
Location :
contig_120:63064- 64519
Transcript NameFunction/comments
g13418.t1hypothetical protein

Sequence
1455 bases(100 bases per row)
GCTTTCTTCACGATGGAGGACGCCAAGGCGGCTTTCAATCTCTTCTGCTGCGTCTACGGCATTGGAACGCTTGGTATGCCCGGCAACTTCTCTCGTGCCG
GCCCCGTGCTTGCCGTCATCGCCATGGGTTTTATGGCCTTCGCCAACGTCTACGGCGCGGTGGCTATCTGTCGCGTCATGTTGCTCGCTCCCCGTTCCGT
CAAGACCTACGGCGACCTGGGTCAGTGGGCCATGGGCAAGCCGGGCCGCTACCTCTCGGTCGTCTCGCAGATGGCCAACTGCCTGCTCGTCCCTTGCGTC
TTCCTCGTGCTCGGCGGTCAGCTACTGGACGGCCTCTTCCCGGGAGCCTTCAGTACGACGACGTGGATCATCCTCATGGCGCTTACGTGTCTGCCGGTGT
GTCTGGTGCCAACTCTCAAGGAGGGAGCTGGTGCTGCTTTCGCCGGTTGCCTGGGCACCATCATCACGGACGTCATCGGCGTCGCAGTTGTCATGTACGG
CATGCGTGGCCACCCGACCATCCCGAAGCCCGACCTCACCTTCAAGCAAGTGGCTGGTGCTTTCGGCAACCTGGCGCTCGCGTACGGAGCCGGTATCGTG
ATTCCGGCGCTGCAGCGCCAGCACAGTGACCCCACGCGCATGCCCCGTGTTGTTGGTGTCACCATGACGTTCATCTCGTGCTGCTTCCTGGTTCTGGCTA
GTACTGCGTACTCGTCCGTCGGCTGCCAGATCTCGGGCAACTTGCTGTGGTCGATCTACCCGGACACGGAGACTGGCCTGACCACGCTGGCTTCGCGTCC
GACTGGGGTGCCGTCGTCCTCGCGTACCTCTTCATGCAGCTCCACATTACGATCGCCTTCTCTGTCATCCTGAACCCGGCCTTCTACATCGCGGAACGTA
TTATCCTTGGCATGCACAAGCCCATCGTCGATGACGTCGAGAACAACCTTCTGAACTATGCCGATGCTGCTACACCCGCTGATGTCGAGCGCTCGGAGAA
GCAGTCGCACGTGTCACGTGCCTCCAAGCGTCGCTCCTTCATCTCCGTTGCCGACAACGAGAACGTGCACCTCGGCGACGACGAGGCCGAGGCTGCCGAG
TACCGCGGCGCGAATGCCATCAAGTACGTGGTTCTGCGGATCATCATGATCGCACTCTTGGTGGTCGCATCGGTGCTCCTGAAGGACCACTTCCACGACC
TGGCCGATTTCGCGGGTGCGTCGTGTATCACGGTGAACTCGATCCTCTTGCCGATTGTTTTCCTGCTGAAGAAGAGGTGGAACGTGCTACCGATGTGGGA
GAAGATCCCGGCGCTTATCGTGATCGTGGTGTGCTTCTGTCTGGGCTGCTACGTAACGTATACGTCGGGCAAGAACCTATTTGCTCCTACCGAGGATGAC
AGGGACTTCCCGTTTTGTGCGCCCGAGTTCGAGAATACTGTCTACTACAACTACA