Description :
From Genome Similarity Track
Location :
Scaffold_934:6306- 7530
Transcript NameFunction/comments
Phyin_T30-4PITG_22023U5 small nuclear ribonucleoprotein%2C putative

Sequence
1224 bases(100 bases per row)
TCGCGCTCTATTTGTCCTTCTTGTTCTCCTCTGTTTCCTTTTCCGCCTCTTCCTGTTCCTGCTCGAGGTCCTCGTCCTCTTCCTCGCTATCACTCGAGTC
CGCAGCGTTCATCACCTGCTCGAACAGCGTAGGCTCGTTATCTAACTCCAAATCCTCCGGATGCGGCTGGAACACTGGCAATGTGGATGCCGGGGCGACG
TTAAACTGCAGCAAAAACAACACAAACGAACCGTTAGAAAACAACTTAACACACACATAATCACACCATAACGAACCTTAGCAACAGCGCGTAGATCCAT
GCCAACATACGAGTCGCTCTTAACGAAAATATCCAGCTGGTAGGTACCAGCCTTAGGCGGTGCCTGCAGCTGAAGCCTCTGTTCCACCACGCGCTCTTGA
GACGTCATTTTGGAGAAGGCGTGCAAGTGGTTCATCTTCACGTCACCCACGATGCAGTACCAGCGCTCCATCTTCGGGTACGGGAAGCGTGGAGCATACA
CCAAGTCGCACGTGTCTCCTTCCTTGACGTTCTTACGTGTAAGCTTCACTGTGACCGTCATGATGTCTCCCTCGGCAATAAACTCCTCGTCATCCACACC
AATCGAGATCTGCAGTTCCATGTGCGGCATCATGTCCAGCACCGTCGTCACTTCTTGACGGTCTTCCTCGGACAACCCACTAAGTCCCTTCCGTTCCTCT
GGCTTCATGGCGATGTACTGGTGCATACTACGCACAGCGTTCTTCCCTGTAACAATGTGCTTCACTTCAGCTTCAGTTAAGTGCGGAAGTTGCAGGAATG
GCGGGTCCTTGAACCAGAGTCCTTGAGTCAAGAACTGCTGCATCTCCATGAGGTTCAACGTGGTCTGTAGCCATGATTTCATCACGGAAATCTCCAGCAT
ACCGTCTACTAATTGAATCGCCTTCTTAAGCATCAGATTCAGGTCTCCTTGCAGCGTCGGACTCAGTTTTTCACGTAGGAAATGCGCATGCAGCAGCAGG
TTGGCTTTGGCGATAGATGGATGGTTGTACTTGGGTTTCGCCATCATATCCGACTGCTTCAGCTTCTTGAACAACGCGCCAAGCTCCGCGTCGTCGCTGG
AGCGACGTGGGATCTCGCGGAACTCGGCGGAACCGGCCAAGATCTCGGGCAACATACGCGGGTGCGCGTGCTGCGACATGGCGAAGTTGTAGAAGCCGTA
CGTGTCGTACATGATCATGCTGTC