Description :
From Genome Similarity Track
Location :
contig_24:630429- 632712
Transcript NameFunction/comments
g4651.t1hypothetical protein
g4652.t1hypothetical protein PHYSODRAFT_560568

Sequence
2283 bases(100 bases per row)
AATCGGCCGAACGACCCTTGTGCGTCAGAATAGCGAACAGCTCGTAGTTTCCCTATGTCAAGCACAACACGAACGTAAGCATAAACCATCCAACCACATA
CACAAAGCACACTAGGCATCAAATACGTACTTGGAAGTCAATAGGAAGGTCAATACCAGGAGACTTGGCTCCCATCGAAAGCGCGCGAGCAGTCTCGAGA
GCCGCTCTGTCCTCCTCGGACAGCCCGTCCATAGCGTCATCCTCATCAGCCTCTTCCTTCGTCTCTTCGACGTCCTCCTTCTTCTCACCTGCAGGTTTCT
GCTAAGTGAAAGCGGTACATCAAGCAAGAACGTAATGAGCGTGAGTTCTCCTTTCTCAATTACACCGCACTGTGATACCGCGTACGTACGTCCTTGAACT
CGTTCAAAATCTTTCGGCATTCCTGTCACGGGAGATCTTCATGGTTGCCTGTAGCTCGTCAGAGCAGAAGTCGAAGACATCCAGTGTCGTGGGGAAACTG
ATAGGCTGCAGAACCAAACGTGTTCCGTCAATGGACGTGCCTAACAAGCGCAAGGAAATACTTTCTTTACCCGCAGCATTTTGCACTTGACACCGGTGTG
GTCGCGGCTCTCCGGCGTCGCCTTCCAGTAGAAGCGCATAAACTGTACGCACAGTACTTGGGCAGGCGTTTATCCGAAGCGTTTTCTTCCACACCGCGTT
GCGATCCAGCACATCCGAGTGCTTCTCAATCGTTCCTTCCAGTCCCTATTCACCAATCACATCTTCAATAAGACACCCAATCTCCATCCCAACCCAAATC
AAAGCAACAATCATAAAACTTACAATCTTGATGCCTTCGGACAGGTGGTTGGTCTCAATGGTGATGTTGCACACGAGCTTGAGCGCCTTCTCCTTCTTCA
AGACGGGGGTCTCCATCTCGCTCTCCGTGCACTCAATTTTCTCATTCAACTCCAACCCAAACAACGCGTCCACGACGTTGCTCGTGGGTCCGAGAGTCTT
TAGTGCCCCCGCGGGTTGCGTCAGCGTCTGCTGCAGCGTCGCAAAGAGCGTGGACAGGAACTCCTCGCTGTCCTGCTGCATGTACCCGCCACTCCTGGGC
GACTGCTGCGCGAACTGCGGGTACGCGCGACGCAGCACGGACACGAACATGGAGGGGGTGATGCTGTCCACGCTGCCATCCAGCTGTGTGTACATGTCCT
TGAGTGCAGTAGTAAAGTTGTTGGCCAGGTCAGCAGACACGCCACCCGCCTGGGCCTTGAAAGCCTCGCGCAGCTCCTTCACGGGCCGCAAACACTGGAG
CGTGGCGTTCATGTAGCACGTATTGCGAGGTTCACGAGGCCTGCGGGATACACTGTGCCAGTAGCTGCGATATCCTTGGTGGTCATGTCCTCAATGAAGA
TAATGGGCTCCTTGGGCTGTTCACACCTCGGCCGTCCCATGAGCATGACACCTGTGCCGTCCACGAGCTTGTCGAGCGTCGAGAGGTCCACGTCGTCCTT
GAGCATCCCCTTCCAGGCCTTGGACATGAGCTTCTGGCGCTCCACAGGCACGGACGTGAGCGCGTACAGCTGCGCCTTGAGCACGGCCACGGGAGCTGAC
TTGTCCACCGCCACGTCCTTGAACACCTGCTTTCCCCATTTGACACTCACCTGGGCCGTCATGACTAGCGTTGATCCTTGGAGCTCTTGTTGGACTGTGG
GGGATTGAAGATCGCGACCTCGAGAAGCTTCATTTGATTGGCAGAAAACATATTATACGGCTGATGATTGGTGGAATGTGATTACGAAATCAATGTCGAA
TTTTGGAAATTGGATTCGTAGAGATTCGCACATGGCTACATGCATGCACTGCTTATAGATCTTAGGATACTTTCTTCTTCGCTTAACGTTTTGGCACCTC
TCATCCCGCTCGGTACTTGGATGTCGTCAAGGCGACCGTATCACGCAGAATGGCGTCGCCCGTCGCCTGGTCTTCGAACCACTGCATGCTCGCGTGAGTG
CGGTTGGCCACATTCAGTAGCGAGAAGCCGTAGTCAGCTTGCCGGAAGGCTGACCACTCCGGCTGCGGGTCGAAATACGTCGGTGCCAGGCCTTCGCGGT
TGCCGGCATCGCCTAGCACAACGTACACGGGGGCGTCTTCAACGACCTTCTGCTTGTACACTGGGTGACTGCGCTCGTAAGCGTGGACGTGTCCGGAGAC
GACGACATCCACCTTGTTCCGGTAGAGAATATCCTCCATGTTCTTCTTCATGATCATGTGTGGCTCCATGCCCTGGTGCGCCG