Description :
From Genome Similarity Track
Location :
Scaffold_7:630321- 632004
Sequence
1683 bases(100 bases per row)
CAATCGGTATGCTTTGGCAGTGTCCGTCCGTCTGCGAATGACCCACAGTAGACATGGACCCTTGTGTTCCAAGTGGTGTAAGCACTTCCTATTAGAACTG
CGCTGTAATGCGGGGATCAAGGCCCAAAACATTGTCGAGAGGCTTTTCCTTGGTGTCGGAACAGCATGGCAACAAACCGTTGTGCAGTCGGCACTGCCGT
GAATTCAGCCGGTACTGCAGCAAAATGAACTATCTTGCTGAATCGGTCAACAAAGACCACAACGCCAGGCATCCGCTTGTTGTCTGGCGGAAGACCTTAA
ACAAAATCCATAGAGTGAACTGCCAACACTCCGACGGTGTCGGTAGGGATTGTAGTGGAGCCTGTGAATACGCGGTAGGCTTCACGCGTTGGCACACTTC
GCTAGCACGTTCGTACTTGCGTACCCACGTCCACGGGTGGTTCCAGTAGAAGTCTCTCGTGAGAAGAGTGTATGTCCTCTCACGACCCGGATGCTCTACC
GTAAGGGCGTCGTGATACACGGACATGATCCGCATACGCAGATCACAACCATTCGGTGCGCATCGTCGTCCTCTGCGCTGTAAGACATTCGTGTACACGA
TATCGGTGTGCACAAACTCGCAGAGTGGTGACAACTTCCAATGTGCCGTGTTGAAAGATGCTAAGACATATTTAGCAATTATTCCGTGTCTAAGCCACTC
GCAGCCGTTATCTTTACCTCGTCGATCAATGACGACGATTAAACATCTACTCGCTCGACGCCAATCCGATTCGCGTCGGCAGTCTTAACAGCGTTATCAG
GTCGACTCGGCAACACATCGCCCACCATATTTAATCTTTCAAGTTTCTACCCAATCTGGAAGTCGTACTCCGCAAAGAGCGGTAACCACTTCGCCATTCG
TTGCGCGATGTGGGGAGCCTTGAATGCTGTTCGCACCGAAGCATGGACGGCGTAGACCACGAACGGTCTACTCCCAGGTAAATACACTCGGAACTTCCCG
AGTGCATACTTCATGACCAAGAGCTCCTTGTCATGTGCGAGATAATTACGCTCAGCCGGCTTCAGTTGACGCGACTGGTAGTAGACAACACGATTATGGC
CCTCGTATCATACGGCATTAACGTGCATCCGATCGTAAAATCCGAGGCGTCACACATGATGTGGAATGGACGATCTTGGTCAGTCAAAGATAAAAATTAG
CGAAGGCCTGCTGAAACTTAGTAGTCCAAATGCATTTCGCTGCTTTCTTCAGAAGCTGGGACAGCGGGCGAATCTTGCCGACGTACTTCGCAACGTACTT
GCACAAGTACGTAGCAATTCCAAGGGACTGTCTAAGTGCCTTCACGTTGGATGGTGTATGCCATTCGTTGATCACTCTGACCTTTCTGGGTCAGGGCTTA
CGCCGTTTTGCCAGACGAGTCACCCAAGAACGGGTAACGCGCTGGCCCCGAAGATACATTGCATCAGGCTCGCATAGCGCTTATGTTTATGCATAAGCTC
TAGCAGCTGACGGGGGCCCTCTTCGTGCACCTCAACGCTGTAATTCCCGTCTACAGCCCGGCTGCGAACGAGCACGTCGTCAAAGTAGCTCGGTGTGAAG
TCACACACTGAGCTTAATAGATGTACGACACATCTATTGAAGGTTGATGGGTCGTTTTGAAGTTCCGGCGGCATTACGAGCCA