Description :
From Genome Similarity Track
Location :
Scaffold_119:63031- 64264
Transcript NameFunction/comments
g9514.t1hypothetical protein

Sequence
1233 bases(100 bases per row)
GCACCGCGGGGTTGACCAAGGGGCACGACCTCTCCTCCGTGGGGCTCATGGAAACTGAGCAAGGCGCCAACTGGATCTCCACCTCGGGTAACACTACCAC
GATCGAGTCCATCCTAGGCGGAGGAGGCATGGACACCGTTCGGCTTCGGTATTTGTTCACCTGAAAACTACTTCGGTAAGTACCAGCTACTAATCCTGTG
AATGGTTCTGTACAGCATCTGGACGGACGGCGAGTACGATCTGGACTACACGTTGGCGCTGGCCCAGCGATTCTCCAAGGCCGGGTACAAGATCTACTTG
GACATGCACTTCTCCGACACCTGGGCCGACCCAACCGACCAAGCCATCCCTTCGTCATGGGACGACAGCTCGGTCACAACTCTTGCCGCTGATCTGCAGG
CCTACGTGACGTCGACACTGAAGTCCTTCACGGACGGCGGAGTCGACCTCGACATCTTGTCGTTGGGCAACGAAATCACCGACGGATTCCTCTTCCCGAC
CGGTCAAATCAACAATGACGACTTCAGTGACTTTGCTACGCTGTGGAAGGCTGCACGGCAGGGCGTGACAGACGCTGTATCGGCCGGCACGACCCAGCCC
AAGGTGATGATCCACCTCGATAATGGTTGGAAGTACGAGACCGTGTCGTGGTTCTTCGACGGTCTTTTCGCGGAGGGCACCGTGACTACCGACGACGTGG
ACGTGTTTGGCTTCTCATTCTACCCGTACTACAGCACGGACGCTACCATCGACGCCCTCACGTCTTCTCTGACTCAGTTGGCCAATTCGTACAGCAAGCC
GATCTACGTGGCCGAGACGGACTGGCCGACGGAGTGCTCGAGCGTCACACTGAGTGGTGACTACCCAGTGAGCGCCAAGGGCCAACGCGAGTGGGTGATC
GCCATCATGGACGTCCTCGAGAGCTTGCCCAGCAGTTTGGGCGCTGGTATTTTCTACTGGGAACCAGCATATCTGACGGTGGCAGGTCTCGGAAGTTCTT
GCGAATCGGCGCTGCTTTTTAGCGTCAATTGGGACAACTGGCCGGAGACGTACGCGACTGCGCTTTCGTCGATCAACATGTTCTCGTGAGCCTAGGAAAG
ATTGATGCAGATGTATGTCGAGAAGGTGTCCATTATCACCTTGTTGCGTACAGTTCAGCGGGAAATGTAAAGTCTCCGTTTGTTTAGTCTCCGAATGCAC
GTGTCAGTGTCAAGGATTGCCTTGGCACCAGCT