Description :
From Genome Similarity Track
Location :
Scaffold_39:63030- 68293
Transcript NameFunction/comments
Phyke_g6313ABC transporter lipid exporter ABCA1 family

Sequence
5263 bases(100 bases per row)
GCTCTCCTAACATCTTGTATGTCTACTATCGTCACTTACGACTACAACTACGCGCTGTGCGTCATGAACTCGGGCTTCTTCGAGATCGATTCGTTCTTTG
GGGACTCCACAGCGTTAACACTCACGTCCAGTTCAAATGGCTCGACGACAATCGACTCGGAAGGGACGTGTGAACTCAAGTGTACAGAACCAGCCCTGGC
AGCCTCTAGTTCTTGCTGTAAAGCAGCGAATACAGTCACAAACTGCCAGCAATCGTCGTCAGAGATTGCGTACTGCAAGTCTGTGATTGAAGACACTGTG
GCTGCGAGTCAACAATGCGGACTTTCAGCAGAGAACACAGCATTAATTGTATGCTGTACAGTGATTCTAGCACTGTTTAGTGCTGTGATATTAGCAGCAA
GGATATATGCTAGCAGACAGACAGGGACTGGGGAGTTGGAGTCGAGGTTTGCAGTTGCTTCAAGAGCGAAATGGGAAACCGCACTGGCAGCTTGGAGACA
GGTTACGAACCTCATCTGGAAGAATTTGGTGATTCGAAGACGGAAGCCAGTGTCTTTTGTGTTTGAACTCTTGTTACCATTGATTCTGACACTGGCACTG
GTGTTTATTGCTAATTTGGACACGATTTTTGGAACGGGGGATACCACGACCAGTTCGACCGAAGCGGCGACATTATCCGGGACCATCTTGTGTACGGGAT
TGGACTCGCTGACGTACACGAACTATGGCGCATTGAGCACCAACATGTCTACGTTTTACAGCAGCGGACAGAGTGTGATTGGACTATTCTTGTTGATTAG
CTATATCAAGTTCGTCTCGacgacgaccaccacgatgGTGATTGAAAAGGAGACGAGGATCCGCgaggtgatgaagatcatGGGGCTGTCGAATTTTACG
CTGTTGTGCTCGTGGTGCCTCACAACTGCGTTGCTGGCCACACCGCTCGCGTTGATTATTGCTGCCGAGCTAAAGTACGGTCAGGTGTTCCCTATGACAG
AGTACGCGACGCTGGTGTTCTTGTTCTGGGCACTGAGTTTGTCCATCGTGAGCTTCAGCTACTTCATCACACCGTTCTTCAATAAGTCCAGAGCCGCCTC
GATCGCATCGGTGCTGCTCTGGCTGGTGCTATTTTTCCCGTTTTTCTCGGTCATGTCCAAGTCCAACTCCTCAAAGTATCTAGGTGCACTTGCGCCTCCA
ACAGCGTTCGCCTTGGGTATCGATGACTTGGTTCGTCGCGCACAGCTTGGAAGGGGGCTTGCCTACGCTATGGGGCTGGTGGAATCGCCCATCACGGTTC
CTACAGCGTTCAGTATGAGCTGGTTCTTGATTTTGGACTCATTCATTTTGGTTGTCCTTGGATGGTATTTCGACAACGTTCTCCCGCAGGAGTTTGGTGT
ACGTAAGCCGTGGAACTTCCTCTTCGTGAAGGAATACTGGCTTCCATCTAGCTCTACTCGTGACGACAAGGAATTATTGGTGCTGGAATCCCCCAATGAC
GTAGCTTCTCCACAGACAAACTACGCATTTGCGTCGCCACGAGGTGTGCGCTTGCTACACCAGGCGTCATCTGATGGATCGATCGTAATGATGAAAGACA
GGCCAGGACTTTTGGCTTCAGTAGAGCCAGTGaatgcagcacttgcagaGCAGGAGCGGAAAGGGACGTGCCTCCAGATTAAAAACCTTCGAAAGGAATt
tgctggagacgacggTGAAATGAAAGTAGCCGTCCAGGGACTGAATCTTACTTTGTATGCTGGACAAATTTCCGCGTTGCTGGGCCACAATGGCGCAGGG
AAAACGACTGCAATTTCAATGTTGACGGGCCTTATTCCGCCGACGGCGGGTGATGCAACGCTCTACGGGCGTTCTGTTCAAAATGATTTCAACGAGCTGC
GCCAAATTATGGGAATCTGCCCGCAGCATGACGTTCTTTTCAACGAGTTGACTGTCGAAGAACATTTGTTACTCTTTGGAACGATGAAGCACATACCATT
CGTGAAGTTaaaagaagaagttgaacGAATGGTCAAAGAAGTCGGACTAGTGGAGAAAAGGAAGGTCGCTGCCAGAAATCTCTCTGGAGGACAAAAACGC
AAGCTGAGCGTGGCATTAGCGTTCATGGGAGATAGTAAGCTGGTCTTTCTGGACGAACCCACTTCCGGTATGGATCCGTACTCGCGTCGCTTTACGTGGA
ACCTGTTGCAGCGCAACCGTGATGACCGGGTTATTGTTCTCACGACACATTTTATGGACGAGGCCGACATTCTGGGCGACAGAATCGCTATAATGGCTGA
CGGGCAGCTTTGCTGTGTTGGTAGCTCACTGTACCTGAAGAATCGCTACGGTGCGGGGTACAATCTGACTATGATCAAAGGAATGGGGTGCGACGTTGAA
GCCGTGGGCGCATTTTTACGCAATTTCGTCCCTGACGCAAAATGTCTGAGCAACTTTGGCTCGGAGGTGGTGTTCCAGCtcccagcttcttcgtcaggTG
TGTTTTCGACGatgctgcaagtgcttgATGATGAAATGCGCCGTTTGCGTATTCTTCAATATGGTGTGTCCGTGACTACCCTAGAAGAAGTCTTCCTGCG
CATCTCTAACGatcgtgaagaaggcgggTTGAGTGGATATGGTGTGGAAGCTGTCGATCAAATTCGCAAGACATCTGCGACGTCAGCAAACTCTCGCGGG
ACACTTGGCAGTATTTCGTCTGTGGCAACTAACCGAACAACATTGTGGAGCCAATACTCGGCGCTTCTGACAAAGCGGCTGCGTATTGCTAAGAGGGATA
AGAAGAACCTCCTGAATGCTGTATGCATTCctttgctcttcttgatcatcCTGGTGTCGCTTCCTGAAATCGATGTGGCGAATTTTATGACGAACAACGA
TTATGCATCAGGGctggcgtcgtcgtcccGACAAGGAACGTGTTCGAGCACCAACTCTTCGTTGGTGTCAGTTCCCAACAATTGTGAAACACTTTCGTTC
AACTACTGCGACCTTGGCGTAATTGACTGTAGTGCTTCGACGTGCTGCGACAAGACGAATGCCGAGTCTCCGTATTATGCATGCAACATTTGTGATGGCA
CTACAGCCTCAAACCCAACAACACCATGCTACAACAGCTATTGTCTCGATCAAGATGGCGCTAAACTCCAAGCTACTTTGAACGCCTTCTTGACTTCCGT
CGTATTGATGCTGGCTTTTGCATTCGTTCCGGCGGCGATTGTGGCGTTTGTTGTGCGTGAGAAGAACCCCAACCAAAACGCAAAAGGCTTACAGCTGATT
TGTGGCGCCAACGTGTCAGCATACTGGATGTCGACATGGACCCATGACATCATACTTATGCTTATAACGGTCATTGCCTCCATGATCATGGTACCGTTGT
CAGATCGCACGTTGAGTAGTGCTTCCGAAGTGCAGGGAGTCGTGGCTCTTGTTGGGTCGCATGCTCTCGCTGTGATCCCGATGGCATACTTATTCTCCTT
CCGGTTCAACAAGCACGCGGTGGCTCAAACATCGCTGCTAGTGTTTGCACTGTGCACGGGCGGTTTGCTGAGCATTTTTTCGTTTCTATGCCGGCTGATT
GACTTTGATTTGACCCCGGGCAATTCGACAGACAACTTGACACTATCGTCACTTGACCGGAACTACCTCCGATGGATTTTTCTGCTGTTTCCCGGGTACA
GCTTGAACAACGGCATTTACGAGATTGCAACGCGTAAATTGAGTCGAAAATCGCTATacggtagcagcagcgaaacGATTGCCCCACCCTCGTTTTTCGG
GTTGTGGAAGGGCCTGGGCACGGATTACACTTGTACCTCTTGCTGGGAAGCGTCCAGCGGCGAAGACTGCTGTGTGCGGAATGTCTTCGACCTCGATGTG
GCAGGAGCTCCTGTAGCTTACGCTGTGGTTGAAATCGTGATTTTTATGGTGTTGGTTTTTGCTGTTGAGAATAAGGGGCTGTCGTGGCGCCCAGAGCGAC
GGCAGCAGTGGTCAcacagtgaagacgacgatgtgGCTAAAGAACGTCAAAAGGTGGAACAGTCCTACCCGACTGACAATGACAGCGTGTTTATCCGAAA
TTTGCGTCAGCAGTACGGACACGGTGGCAAAGTCGCGCTTGATGATCTGTGCCTCTCAATTTCCAAAGGAGAATGTTTCGGCTATCTTGGTATCAACGGT
GCTGGTAAATCGACAACAATGAAGGTTCTGACGGGAGAAATTGCGCCAACTAACGGGTTCGTTACGTTAGGAGGTTACGATCTCTCCAAAGACCGTGATA
AAGCGAGAAGAGTTGTCGGCTATTGCCCTCAGTTCGATTCGTTGCATGATTTACTGACGGTAGAGGAACAGCTGGAACTTTACGCGCGCCTGAAGGGGAT
TCCTAGCGACCGTGTGAAGATTGCAGTTGACAAAAAAATTGAGGAGGTGGGGCTCGAAGAGTATCGCACGAAGCTGACTCGTGGATTGAGCGGCGGTAAC
AAACGCAAACTGTCGACAGCGATTGCGCTGATAGGATCTCCAAGCATCATCTTTTTGGACGAGCCTTCGACGGGGGTGGATCCGAGCTCACGACGAAAAA
TGTGGGATGTGATCGCAAGTGTCTGCGCAGCAAAAGAATCAAGCGTCATTCTCACGACTCACAGTATGGAGGAGTGCGAAGCGCTATGTACGCGCGTGGG
AATCTTAGTGAGTGGACAGCTGAAATGCCTGGGAAGCGTAgagcacttgaagcagaAGTTCGGTCGAGGATATATCGTAGAAGTGAAGTTGCGGGAgcca
aactcttcttctgtggggcggctggagctggaggtgtATCGCATCCTGGGCGGGAACAGTCCCGGTATCTCCCCAGATAATGTCATAAGTCTGTGCTCGT
CTCTTGGAGTGTCGAATCGTGCGCATGAAATTATGAACGGCGAGGGCAATGGAGGGGTGCTACATAGTTACCTCGAGACGTCTGGCATCATCCCAATCAA
CGTTTTTTGCTCATGGTGGCACTCTGAGAACGCTGGGTCTGCGTTACTATCTTTCTTCGAAACCAAGTTCCCGAGCTGCGAGCTGGTCGAGCACCAAGGC
AGCCACTTCCGGTTCCAAGTTCCAAAGCAGTCGCTGCGGCCGTATGCAATATTTGGGCTGTTGGAGGAAAGCAGGGAACAGCTACAAGTGAGCGAGTACG
GTGTGAGTGAGACATCGCTGGAGCACATCTTCAACACGATGGCCGCACAGCAAGGAGAAGAGC