Description :
From Genome Similarity Track
Location :
Scaffold_52:6303- 7664
Transcript NameFunction/comments
Hyaar_Emoy2806543hypothetical protein

Sequence
1361 bases(100 bases per row)
TCTATGCACCACACTGTGTCACCTAGTACAGATGAAGGTAGGAATTAGGACAAAGTCCTACGTAAGTACCATGGCCACTGTGGACAACATCGATCTGCTG
CATCGATTGGATTTTGCTAGCTGATCGATAGAATGTCCACGGCCTCAAAGCTAGCTATAAATATCTTGTAGTCTATCAGTCCCTGCACATACCGAAAGCG
AGACGCTAACAAAAACAGTATTCAATGTTTATGATGCAACATGAGTCGGACAGTAAGGGGGCAGCGAAAAAAAACGGCAAGTCCAACGGTAATGCAAAAA
AAATGTAGGAAAACATCTATCGTAAGCAAGACCATGTGTTCTCGAGATTACACGGCTCCCTCAAATTTGCCTTCCTCCTCGTCATCGTCGTCGTCTTCAG
TCGCATCCGCCTTCACGAGCACGCCTCTATCCGAATTCGTATCATCCTCTGACGCATCTTCATCAGCACTATTTTCGGAAGCCATAGCTACGGAATCCTC
GTCTTCGTTTGCCGTACTGTTCGTACCACGGTTACGACCAGAATGAGCGACGAACGCGAATGCCATGGCAATGACACCCACGAATACGCCAACACCTGCA
CCGATCTCGGAAAAGTAGGCAGACGTCTCAGCGCTGTCCTCTTCCGCACGCTCGCTGGCAAGAGCAACGCTTTCATCGCTCGGCTGCTCTTGCTCTATGC
TCACCGTATCATCCAGTGAGCCCGAACACGAAGTTGATGTCGTGCCATTGACCGTACTCACTACGTCTCCATCTGCGTCTTGTGTCGCGCTCTCCGCACT
ACTGTACACATCATCCATAGTGTCATGGTCAGCGTTATTCGCACTGCCAGAAGCGTCTTCTGTAACATTCTTGACGTGTTCATCTGCCTCAACAGTTTCG
TTCGTGACATCTTGGTGCGCATCACCGACTCCACTTGAAATGCCTTCGACAGCAATGTCAACGCCCTCATCAGAGTGCGACTTATGCGAACCGTCGTCTT
CACTTGACTCGTCCACGTTTACCGACTCAGCGCTCGAACCGGAACCAGAGGCCAAGTGCGCACCATTTAGAAGATTCTTCGTTTTGTTGGACACGTCTAC
TGTGGCGTTTTCTACATGCTCGTAAGCATCCTCAGTAGCGTTGACCACTGTGTCGATTGTATCACTGGTCACTCCGGTGTCGTGCTTTTCATCTAGCTCC
TCACTCCCATCGTCCTTGTCCGAGCAACTCCCACTTTCTACGTCGTCGTCTTCGCTTCGGCTGTCTTCGCCGGAGAAACTGTCACTTCCATCTGTTTTTT
CCTGCTCCTCATCCTCCTCTTCACCGTCCTCCTCCTCTTCCTCGCTACCAGCAACATCCAC