Description :
From Genome Similarity Track
Location :
contig_8:630196- 635593
Transcript NameFunction/comments
g1666.t1Dynein heavy chain 6

Sequence
5397 bases(100 bases per row)
TTCTCAAGCATGTACAGAATCTTGTCTTCGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCATTCTTCTTCTGCTCTAGGTCAG
GACGCTCACTTCGCACAACGTCCACCAACAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTGATGCAGATCTCAGGCAT
GTAATGCGGGTTTGCAAGCTTTGTGGTGATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGC
TTGAACACTTGCTTCAATAGCACGGGCTCCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCA
ACGTACGCAGGAAGTCCTTTTGCGATAGCTTAATGATCTGGAGTGAGTTTGATGCTTTATACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATC
GATCATAAGCGGCCAGCGGCGCCCCATGGTTGTGAATAACCCATTCTCAATCGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACA
ACGGGGTCGGCTAGCACGCGCTGGAAGGAGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGT
ATTCCGATGTAAATGGGCCAAGGTACGCGATGCAGCCTGCGGACAGGATCATGTCGCCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTC
TTTCCAACGGCCTTGCTCCTCGCCCAGCGAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTC
TTCTTTTGGGCATCCTCAAGTGTTCGTTTCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTT
CGAGTCGCTGCTCGGCTGCCTTAAGGTTCTCCTTCTTTGGAGCAATGTTCTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGAT
GTTGCAGCGGTGGAGATACTGCTCAGCGTTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCCT
TGTCGAACTCTTTGAGTTTGTCCAGAAACTTCATATCGTTAAGCAGCTTTTTGGCCTCATTCCACTCTTGCTTTGAGCCGAATAGAAGGCACACAGCGTT
CATTGTGACACCCACAAGTCTCGGGGGATTGGTGAACGTCTTCAACACCGTAATATCATCCTTTTTCAACTGTGACAGCGCTTTGATTGACGCGTAATGC
GGGCATAGCTTCATCCAAGTCCTTCTGACAGTCGTCCTTGATCACCTTCACTTCGTCAGCAATCTTGTTAGCAGCCTCGACATCAGCCTGAATTAGTTGT
TGCTGTTTGTCAGCTTCTGCCTGATCCTTTGACACCTGTTCAAGCAGCAGCGATGTGTCCTTTTGAGCTTTGACTAATACCGGCTGCAACTCAGTAAGTG
AGCTCTTCAAGTTGCCTACGACTTCCTCGGTCTCCGTAAGCTTCTGCAAGCCACCGCGGTAACGTGCTTCCTTCGCACGTACGAGCTGGCGATGTGTACG
CAGCATATCCACGTACAGTCGAATCAGCTCCAAGTAACTCGTAGGAGTGGTGTAGTTACGACGCTTTAGCTGGGCGTAAAACCGAAGAGTAGCTTCTTCA
ACACTGCGGTGAATTGTCACGGCCATGCGGCACAATGTGTCCACATGTGTGTCAATACCAGCTCCTCAGCGTTCGTAGCGAAGAAGCGGTTCGCCACTGA
GTTAAGAGCGTCTTCTGGCCATGCATTGAACCAGTCGATGGTACAGCAATTCACGAGAGACGGAAACATGCGGCAGCGGTTCCGGAAGCCAGCGCCGATA
GGAGAAAATGCCAATACCACATGCAAATTATCACGAACAAGAGTCACGTAGTACTGGAGAATATCTTCGCGTGTAACTTTGCCCACCTGCTGAGCCAATG
GACGAACGAGACCCACAATTTTCTCCACTTCGTCGCTCGCATAAAGATTCGGCACTTCACCAGTATTAAGGACGTTGTTAATGTCTTCAAGAAAGGATTC
ATGAACGATTTGAGCATCCGAAAACAGGAAAACGACAGGCTGGTTTGAGCGCCTGCAGTCATAAGGATCTTCTTGAGGTCTTCGTGAAATTCATTGGCGC
CATATCCACGAGTAATTTCGATCGAGAAACACTTGTAATCCGCCATGAATGCAGCAAGACGTGTAAGACTCTGACGACCTGAGCCACCAACTCCAACGAG
TAGAGCATTACCGCGAGGCTGTCGCAAAACACGGCAAATGCGCGAGATATGGTGCATGGCATCGTTGAAAAACACCAAGTGCATCTGACTCGGGAACGTG
ATGTTGTACTCTTCGAGATACTCTGACAGCAGTGAATTGAGCTGTCCGAGATCTTCAATCGGTCGGTACGTACGGTTTTCGCGCGTAAGGTAATCGCCAT
ACAAAATATTCTCGAAGCGCGGGAGGCCACGAAACTCGGAGCCTCTCCTCGAGTAGTTGCGAACAAGCCACATTAAACCAATCTCGATCATCAGCGTCTA
CCAGACGATCACGGAAAACTCGTGCTTCTTCATGCAGCCAAAGTGTTAGCAGGCCATCTTCGTTCGGTACATTCTCCTTTTTCGCCATCAGCACACCCTG
GAATACTTTAAAGATCACGAAGATTGAACGTGTAATGTGACTTCGATGGTGTAGGTAGCATCTCGAGCTCCACGCGCTGGTACAGCTGCACCGAAGCGCT
CACAATAGGTGCTGCCATGTGTGTCATTGCAGGCAACTCTGCACCGAGGAAACCGCCGAGGATTGATGAGAAGATCCGCTGCATAACCTCACCAGAGAGA
TTGGGATCCAAACCATGTGGAAATGACGCATCAGACGCGGGGTCACTTCACTGCGACCACCTCCAGGAGGAGCACATGCGGCGGCAAACACCACATCCTT
CACATTTTTAAAGAACATTTTGGATGTGTCGTAGAAACCACCTTGGTCGATAACTTGCCGCAACAACTCGTTAGGAGGCTGCGCGCCATAGATTTCGAGC
GCCGGCATATTCAAATCATCCACAAAGAATAGCATGCGCTTTCCAACAGGTGGACCCAGCAAGTTCTTTCGCTTTTTGTCCAGCTTTAGCTCGAACATCT
CGTTTAGGTTGCGAGGCTTGGTTTGCGCCGAGTAACTCATGGTAGACAATGCAGCTATCTGTCTTAGCCATATCATCCAAGAACGACTGGACAATAACAG
ATTTGCCAACACCAGTCTCGCCACTATACAGCACGTGATGATCTGAAAGCATGAGCTTCTCCAAGAGATACCGAAAGCGCGTCGTGTCTTGCGTGGGCAC
CACCATCGTGAAATACGACGCTCCGGGACAAACGTGAAAGTCGGGGTCTTATCGATCCACGAGGCCCACTGGCCAGTTGAATCATCTACTACCACTTCGT
ACACATTAGTCACGGTGTGCCGTCAGGACTGCTGTCGATCAGTGAACGGAATTGGCCCATGGAGAAGTCATTGAATTTTGGACGCGATGCGTCGTCGATG
TTTGCTCCGACAGACCACGTAACAGCAATACAAAATACATGCGCATAAGTCCCGCTAAATTGCTAGCACCAGCGGTTTGCACAGCACCGCTAGCGAGACA
GGATGCCAGGAGATTGAGACAGCTCTGCATCAGGTTAGCATTGTTGCTGGCACCTTTTCTCGGCAGTTTTCGCGGACAAAATCAATCGCCACAGGAACAT
GAGTCTCAATCAACAAGAGAAGCATATCGCACAGCTCTGGATAGGCCGATAGAATCGGTTCCAACGTCGTCACTTTCCAGTTCGCGCCAAGGATGTCAAT
CCTACGTGCACTTGCTCCATATACACCATGCCACAACGCTGACAGTAGCCGGCGAGCTACACGGAGATCCTGTACCTCAAACATCATGTGAAGTGTGTGG
GGCAGTTTGATTCGCTCACTGTTCGATAAGCACAATGTCTTGTTCGTCCAACACCGTATTCATGTTCTCAATCCAAACAGCATCCACGGGTCCGTCAAAA
TGACCCAGTTGCGGTTGTCAGACTCAGCGGCTTCCTGTACACACTGTCGAACCAACTTCGGTACTAGTCCATCAGTCCACTCGTTCGTTAGGAGATTGAA
CTCACCATACAACTGCCTGCGGAGATAGATTTCGGGTTGAGGATGAGACGCTGGACCTCTTTGTAAAACCCATCGCGGTCAACAACACCATCTTGGTAGA
GTTGAGTCAGCGCTCTCGCCAGCACGTATCCATTCGTGGTCTTTCCACTACCAGCTTCACCGACAAGCATCATACCGTGACGGACCAACTGCGTCTCGTG
AACCTGAATCGCCTTCGTGATAAATGATGGCACTTGTTGCAAGTGAAGCAGGTCCAACTGTTGCTCAATGTTTCTGGAGTAGCCCATAGTCGACAAAAGC
ACCACCACAACGCCTGGGAAGAGGTCTGCAATAATTCCGCGAAACAATGGGAGATCCTGCTCAAGGAACTAGGTACATTACTGTCTCGCATAGCTCGGAT
GAGAAGCAGATCCTCAGCATTTCGGGTTCCTTGCGTTTTAACTGGCCAGCAGCAACCAACACAGACTTGACGGCTCGCATACCGAAATCGTAGTGATCTT
GCTTTGACAATTGCTCACTGGAGAGCGAGTAAAGCTGAGTCATCTATGCGACAGCGGCAAAGCATTCGCAAACCCTCCGAGAAAAGCACGATCTCGGCAA
TTAAACGGTAGTCCGGCACCATCATAGCAACGGGCGGAAAAGTGCCTTCAAGTTATCTGGAAGCTCCGTACGTCCAGCATAACCCGGATTCATTGTAATG
AAAACGCCAAAACCTGTGTTGAGTCTAATGAGATTGCCTTCAAACTCAAACTCGTCCACGTCAGCTACAATGGCCTGCTGAATGCAAAGTACCTGCTGAG
CAATCACAGACAAAACTTCGATATCAATGCGTTGAACTCGTCGAAGCATGCCCATGCACCAGCCTGAGCGAGGCCAGAGAAAAATCGTCCCATAATCTTG
TAATCCAGTCCATCGAGCAGTTGAAGACGACACACTGCACTGCAAGCGCTTTAGCCAAATCTTCGTGTTCTGTTTTGCCTGTACCGGCTGGTCCAGCAGG
AGCGCCACCTAAACGTAGATGCAGTGCACCCGTGAGTGTCATGTAGCAAATGTCCGTCAGGGGCGTGATCACAAGTCTCGTGAATTGCCAAGATATT