Description :
From Genome Similarity Track
Location :
contig_164:6301- 8179
Transcript NameFunction/comments
g11851.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
TGTAAATACAGGACTGGAATGGTTATTAGAGTTCATTTCTAGGAATAGAAACAATGGAGCGATTCCCACAGCTATTCTGGGATGCCAAAACATAGGTTTT
AGCTGGTGCGCACAGATTTAGAAAAGGGCGTGCCCACCCGCAGCACCTTGTTCCGCATCTATAGCAGTATGAGTTACGAGGGCAACGACGAGAGCATTGT
GCTCATTCTGATGCTTGCATCCACCGCCGAAGGCAGAGAGAGAAGCGTGATCGTCAGCGCAGCCAACACTACCTCACGAGAGCCAACCTCCACCCGGAGC
CACAATATGGAACGGCATGGGAGGCGATGTACGGCGCTGGAAATGACAGACCGTTTATCACTACGACCGGATTTTGATGTTAGTTGCTCCCACTACTTGC
TTTCGCACTATGAACTCAGGTAGGGTGCAAACAGGCAACGGCATGAGTTGGCACCTTCATTTTCGCTTAGCGCCGGAGGAGTGTGGGATGCTGTCGAGTG
GCTGTCCTCTTCATTGCTCAAGCTCTTTCTTCGCCAACGGTCGTTCTCATAGACACCTTTTCTTCGATCCGGCACTGGATCTGACAGGCCACCCGGACAT
TTTCAGGACACCTTGGATCCCCCATTGGCTTCTTGACGTTTAGCAACGCTTGCAATTTCTTCTTGAGCGCAGAACGTCACTAATGAACTCCAGGAGCACG
TCCACATCCTGGGGCTGTCATTCTCGACACCTGCGACCCTCCCGCGCCTTGTCATGATGCTTGTGGTTGGTGATAACAGCTCAAGGCTTGAATAGGTTCG
TCTACGCGCCTCCAAGTTGAGAATTCCCAGCTCCTGCTCGCTCTGCTGGTGTCGCCGGCCTCTGTGTCCACCTCCGCGTCCGTGGTGGGCAGTCTGGAGT
TGATGCGGGACAGACCTTGATGCGGAAAAAGAGTGTGGCTTGTTAGTTAAAGTTATTAATATTGACAGGTAGAGCGCTTAAAAGAGGTATTTTATTCATG
TTCGCAGGTTTATTCTGCCAAAAACCAGATCCATGATCTGAAAGAGGGGGGGGGGGGGGGGCTCTTTCAGATTTTGAGTCTGAACCGCTGCCTTTAATCA
ATAAACGCATAAACAATCGCGAATTCATGTCGTAAGCCGGCCGATCCTCCATTTTGATGTTTTAATGGCTCAGAATGTCAAATGTCGGGCAACTTATCCT
CCACTGCAGGATCCGTTGCCCGACATTTGGCTTTCCGAGCCATTTAAACAGCAGCAAATATTTTATTTGGGCAGTACTACCATCCACTCGCCGCCTAGCC
CTATTGAAGAATAAAATGGTTTTTCTATGTATGGGGTAGGGCAAATCTTGGATTCAAATGGCTGCGGGAATCGCTCTATATAATAAATCCATCTTTCCGT
CTGTCCGGCTAACAATGCACTTTCATACTCAGTATAAAACATAGTGGTGCCAGTTTTCGGACACAGGAATTGGTGGATGCAGATCATCTTTCGAACTAGT
TCGGTTTCCAATAACCTTGTTCGTGGACAACTGCAGCATCTACTCTCAAGACTTTCGGTGTCGAGCCATCTTTCGCATTCATGTGTATGGTATTTGGACG
CAGTATGTTAGTGATATATTTGGCCCGATTGTGCGAGCCCTGCGGCGTTGGTACAACTTTTTTTAAACTAACGGTACGGAAAGGAAACGATCCGCTCGTC
ACGATGTCCGTGCGATGTAGTAGCTCGTGTTCACAAGTACGTAAACGGCTATCCTACCTTCTACTTAGAGGAACAGCCGGCAACATATTGATTTAGGGAA
GGAACACAGCACTGGCTGGGCGAACTTACTCGAGGCGAGTAACTTTTCTGCAGCAGCACGCCACGATGCAGGAGCAGC