Description :
From Genome Similarity Track
Location :
Scaffold_1482:630- 3355
Sequence
2725 bases(100 bases per row)
CTCGAGTATTTCAAGATCGCGAAGGTTCATGATGCTCCTGAGGTCATGAGAGTCACGGATGGTAGACCTACGGTTTTTGACTTGGGGATTCCTACACCCA
CGAACATGGGTCCGGTCCTTGGCCGAAGCTCTTACATCGATGACATCGGGTTTTGTTCCAAGGATCTCGGAGAAATGGCCAATATGTTGGATGCTCTCCT
CTATCGGTTGAGGTATTGGGGTGTTTCGGTTAGTTTGCCTAAGAGTACCTTCGGAATGCACTCAATTCCGTACTTGTCGCATGACATTTCGCCGGAAGGA
GTCAAGCCGATCTCCAAACTCGCCAAAGGCCTTAAAGAACTTCCGTTCCCcAAAACTCTGAAGGGAGTTCAGTCATTTCTCGGATCCTTGAACTACTATC
ATAAGTTCATTGAGGCTACTCGGTGGTGGCAGCTCCTCTTTACGAGTTATCGGACGACCAGGTGCGAGCTGGGACAGATCTCGAGTCTGCACATGCAGCG
TTCGAGGTTCTGAAAGCCAAGATGTTGAAAGCTCCAGTTCTCcGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGCTCCAGTTTCCCCAAACACTCCCACGGTATACATGGTTCAGACTCGAAGTTCCAGGAaCCGACCCCCcGTTTCc
TCACCGGACCTCGAACCACCTCCTAGCTCTGTCGGGGGgCGTACCGGCGCGTCAGAATCCCAAGGTTCTTCATCGGAGAATCCTGGAGACGAGAATTTtC
GCGCAAATATCTCTGCAACAGACCTGGAGATGGCTCGAGCTGAGAGGTGGAGGCGTATTAATCGGAACCAAGATGCAGACCCCTGGATGAAGTCGCTCAT
AAACTACCTCCGAGGCGATCTCTCCGAGATCTCGCAGGCGAAGCCAGCAACTTTGCCAAAATCGCCGAACGATATGTTCTAGATGAAGAAGAAACGCTAC
TCTACGTACCTCCAGTCTCCAAGAGACGACCCACTGGTAGGACTCCAGTAACCCGAGTTGTGGTTCCACACTCGATgCGGGATGACGTTCTACACGAGAG
TCACTTGGATTTTCAAGGTGGACATCAAGGAGTCGGGAGGACATATGAGAAAGTTTCAAGGAAGTTCCACTGGGTCGGTATGTTCAAAGATGTTGAAGGT
TTTGTCCGAAGATGTGTCGACTTTTAGAGGGGCAAAGGAATCCCCAGGCAACATCATGCCGGAGTATCCATTTCACGTAGTATCCATGGACTTTATCAAA
CCTTTACCAAATACCGATCGTGGGAATACGGCTCTGTGAAAGaCTCATGTTTGCACTCAACACCTCCTACGACTACACTCGTCAGGAAACTCTGTTCTTT
CTGGTCCACGGATGGGATGCTAAGTCGACTATGGCCGCCATGCTAGGTCCGCCACCTACCCGTCGAGATCTTGTCGACCCTTACCGTTGGAGAATCCGGG
TTCAACGCCAAGTCGAGTATGCTCAAGCTTGGGCCCgAGATCTACAGGCCAAAACCAAaGAAACGCGAGCAGAAGCCcGAAATCTCCAAGTTCAGAACAT
GCCAGATACCGTTCCGATCCCTCGGGTCCGTCCGGGTCTCACCAAGAAaCTTGCACACTTGTGGCATGGCCcTTTTcGGATTGTGGAAAAGGaTCCAGAT
AACGACTTCCGATACAAACTCAAGGTCGATGGCGTCGAGTATCGTTTTTTtCCTtGGGTCCATGTTAGTCGCTTGAAGCCACGCATCCAAGTTCCTGAAC
GTCCTACGGTCCAGTTGCTCGAGCTCGAAGAGGATGACGAGTTCGATTCGGCACTTCTGCCCGAAGATAGTTGgCAaCCTGAAGAATTGGCTGGAGAATT
CGAGGTTGAGAAGACACTGGATGGC