Description :
From Genome Similarity Track
Location :
Scaffold_2177:630- 3195
Sequence
2565 bases(100 bases per row)
CCTGCGCAGTCCGACAAAGCATTGGTGAGTCGTGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGAT
GCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGCTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGC
GGGTAACTTAGTTCTGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGATTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTA
ACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTAACTCAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTT
CCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATACCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACG
CCGTCTGCAAAGACGCCGCCGCCGCCTCAAGCCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGCCCAGGGCCCGGGCTCTTCCG
ACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACTGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAGCCGTTGCCAGAGATTGCAG
AGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAGATTGCTGATATGATACTCATGAGACCTGAGACCACTCA
GGAGAAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGGAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCC
AAGGACCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCGCACCGGATCGAGGCGTACGACACGAGATTG
ATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTGCTTCGCCGCGAAAGCGAAGGC
AGGCATGGTGCGGGAGTCGAAATCCCATCACTCGACGCCGACTTTCTGCGTTCGTAAGCAGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTG
AACAACGCGACGGTGCCGGCTCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAG
ACGGATACTACCAAATTCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGG
CTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACAGACGTACTTCGACGACATAT
TCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGTCACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGC
CAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTTTCGGTTGCTTCGTAAGCAACGTGGGCGTTCCGGCTGACCCAGACAAGGTCAAGGCC
ATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGATTTGGCCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTC
GCTAAGCCCTTGTCGAGTCTGCATCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCCAGTCTCCAAGAG
GCCCCTGCCCTGGCCCTGCCGGACAAAGTGATACCTTAGGGGTCTAACGTATAGATTGCAACATTTGACCTTTTTGTGTACCTGCTTGTGACAGAAGGTG
CGTACGAACTTAGACTGAGATGCTATATTAACGTCTTCCAGATCAATTTTTAAAATAAGTGGCATAGTTGGATTCGTCGCGAAATTTTACCCCAGAATAG
CCAATTAGTCGACGGGAAACGAACTTAAGAAGGAACTAACTTTCTGAGTTTTCATCTTGGCGAAAATGACAAACTGAAAGCATATATCGAAATATCGCGA
AATGCTCTTTCGAATATCTAAAAAAAAATTAGATTTCGTTTCGGGGTGTCTCAAATGAACCTTGAGGGTGGCTCTTAACCACTGCCACGCGTGCCATGCC
ATGGCACTAGAAATTGAGCCATGGCATGGCGTGGTTACGAATAGAATTGCCCTGCCATTGAAAACTATTTTTAGAACATACATTATTGAAGATAAAAGTA
GCATGGCACATGGCAATTGCCCTTTGCCATGGCACTTGCAAATGCCATCCCTGTCAATTTATTTACTTTAAACTCTAGCCCTAGCAAGCGCTCATCCAAT
CGGATCAGAGCATTTCGTGCCATGGCACTGAGAAACATGAATCCTGTCGTCCATGTGTTATTTAT