Description :
From Genome Similarity Track
Location :
Scaffold_487:630- 20041
Transcript NameFunction/comments
Phyag_g6103hypothetical protein PHYSODRAFT_247554
Phyag_g6104hypothetical protein PHYSODRAFT_532525
Phyag_g6105hypothetical protein PHYSODRAFT_362533
Phyag_g6106hypothetical protein PHYSODRAFT_532795
Phyag_g6107hypothetical protein PHYSODRAFT_307569
Phyag_g6108conserved hypothetical protein
Phyag_g6109conserved hypothetical protein

Sequence
19411 bases(100 bases per row)
TCACATGCGCGACCACCCAAATGGACCTCCGGCAGAAAAGGGAGCTTGCCGCTTGCCGTGCACACACAGGGCGCGGCTAACATGACGGCCGAGCTTGCGG
CGAGCTCCAGAACAAGAGCACGGccaaggagatggaggcctCGCGCACGTTGAGCGGCCTCGCTGCGAACGAACGCGGACTGCAGGCTCGAGTCCGTGGC
ACACAGACTCTGTGCACTGCGTACAGTACGGCGCTCGGTCCGCCCCCTTCGGCGCTTTCTGCGCGCCAAGCCCTTCTCTTGCATTTCGGAGCTCGTCACC
AAGATCGCGTTCCGGTAACGGAGACCGCGgcgaacaagcagcagcaacgtggcAAATCAACCGGCGTATCGAGACTGCAATTGTcgacttgaagctgcca
tGCACTAATACCGACtgcagccactgctgccAGAAAACTCGATGCCATGCCAGCAATACGGACCAGCGGATCTCGATGAGGATCCTACAAGTTGGCGCCG
ACCCACGTCGCGGCCTGCATTGCAATCGCTCGTCCGCAAAACCAGTTGCCATGCAGAGTCAGGCAGGTGCTCTGCGATACACGTGAGAGCCAGGCCGGCG
CAGTCACCTCATCGCGCGCAGTTGTTGCACTGTTACATCGCGCCACCAAGCGTTGATGACTCGATGAGCGCGTCGGGTGCCTAGTGGAACGACAGCATGG
CGCGAAGCTCACGATGGCAGCAGGCAGAGGGAACATCGACGGCAccggtagcagcagcactgcctTCAGCCGAAGGTCATCGCTGCCTCGCACTAATGAA
ATGCAGCCCGGCCGTGCACGGCGTCGCCGCGGTTTCGTAAGGCCATTGCAGTGATCGCTTTGGCTCTTCTCTAAAGTCGCGAGCGCCGCGCTTGCACTCC
TGAAGTGTAAGGCCGAGCCTCGGCGCTGCGCGCCGCCACGCGCGACCGACGCGACGTTGTTTGAAATGACTGCAGGCTGCAAAGCGCCCACAGCGCTGGG
TATCCTTGCCAGGTCGGCTCCATTGACGAATTCCGTTTTGCTTGGTGGGCAAAAAGAGCCATGCAGACACCGCGACCGAATGCAGCAAATTCGCATGGCC
GAACTGCAAAcacagcacgttgctgcagttgcgGACGCCCATCGTGCAGgagcgcgctgctgttctcgcgGAGCAAGCGATCCACATCGCGGGCGAGGCT
GCAAGCACATACAGTTTGGCTCTGGTTGCATTTTGGCGCCCGGACGCCGTTAAATCGCCTGATCCAGCGCTCGAACCCGCCAATCACGACGCGCCATTAC
GCGTTTGAAATTCGGCGGCAAGAGCCGCGATTGGTTCATCCTTGCGCGATGTGCCTGCTCTCTGTCACGCATCATGCTGGCCCAGAAAAGGGATGGGGGA
TGGGCTGGGACACGCGAAGGGATCTGGTTGTACCTTTGCAACCGCGTCGCCGGACGTGATTGGAAGGCGACAGCGGTGAAGGCTCTCGGCGCGTGTGTGC
ATGTATAGCAATCTTGAGGTCGCCCTgcagttggcgctgctgtcgcgaCGGCCAATTTCGTCCGTCGTCGACTAACTGCCATATCAGGGAGAGGCGTGTC
TCAAGAGACCAGGCACAGATATTTTTTGAGTGGGGCACACTCAATTGGACACGATTCATTGCGCAGCTGCTCCCCTAGCCCGCGACCGCCCCTTCTTTCC
CGTCTGTGCATAGCCAGATTTCGAGGGGGGCGAACCGAGTGAGTGGTCCTGCTTTAACCACTGTGTTTCCTACCAGGCCGTTGGTACTCGAGCTCCGcag
tcttcgtcttcgtggTGCCTGTCTCCGAGTATTTTTTCTGCCGGAGTCGGGGCCCAAGCGAGTTTTATGGCCTCCACCACGACCCAggccgcgtccagca
gcagcaccgccatgCCGCAAGAtaccagcgccgccgccgccacgctCGACGCCTCGGCCTTCAACTACGACCCGGCCTCCTACCAGCAGTACGCGCAGTC
GGCCCCTGCCTCGGCCAAGTCTGTGGCGTCCAAGGAGCCCGTGGCCGCGGCGAACACGCGGCTCAAGACCGAGAACACGTCGGCCAGCACGTCGCCCACG
AGCGTCACCAAAGTCGAGAACTCGGCCTCGTCCGCAGCGGCCGCGCCGGCCAAGACGGGCACGCCGCCGGCCCGCAACGAGTCGCTCAAGTCGAACCGCC
TCTGCACGATGCCTGGCTGCACCAAGCGCGTGCGCTCCAAGGGCCTCTGCAAGGCTCACGGCGGCGGCCGTCGCTGTATGGTCGACGGCTGTGAACGCAG
CAGTCAGGGTCAAGGGCTCTGCATCCgtcacggcggcggcaagcgCTGCACGCAGCCTGGCTGTACGAAGGCTTCGCAGTCTAACGGTCTTTGCAAGGCT
CACGGTGGCGGTCTCCGTTGCCAGAGCCCTGGATGCACCAAGAGCAGTCAGGGAGGCGGCTTCTGCCGTgcgcacggcggcggccagCGCTGCGAGAAGG
AGGGATGCAACAAGGGCGCGCAACGCGGTGGCTTCTGTGCCGGCCACGGTGGCAGCCGTTTCTGCCAACACCCGGACTGCACCAAAAACGACCGTGGAGG
AGGTTTCTGCGCTGAACACGGCGGTGGCAAGCGTTGCGACCACGCTGGATGCAACAAACCTGCACGCAAGAAAGGCAAGTGCTCGTACCATGCTAATGCT
GCCAAGGGCAAGCTCCCCAAGGACCAATTGGCTACGGCTGGCGTGCCTGGTTCCTTGCCGCAGCACATGATGGACATGCGACAGATCACGACGCCGACGT
TCGCGATGGGTGTCAAGGATTTGCGCGACGCGcacgttggtggcgttgacgCCCAGCGCGCTGcgtacgtgcagcagcagcgcgtggagaTGGACATGCG
CTACAAGGCGTACGAGGCGTCGGGTAATGCCGGACAGTATCTGCAAATTCACGCCGACCAGAGATCGTACGAGCCCATTAGCCTGCaggctgctggagct
gcgcgccACTACATGCCTGTGGACCAGAGCGCTCTGCCGCCGGTGTCTGGCAGCATGTACAAGCCTGGAGCCGCGATGGATCGCCAGGCCTACGCAGCGC
GCGCCGCCCCGGAACAGATGAAGAACCCGTACACGCAGCACTGGGCGGCCAAGCCGGAGATGCCTCAGCACCACCCGGATGGAAGGGTCGACTATTTCGA
TGTGaacaaggagcagcagcagcagcagcaagcacagcagcagcctggACACCACTTGCCGTACTCCGCCCAATCGTCCCAgtaccaccaccaccttaGC
GCAGCAGActccgccgctgctgccgcggCCTACGGCCAGCGATActacagccagcagcagccccagcaaGCTCCCGCATCCGGCGATCAGTCGGctcccc
agcagcaggcCAACATGATGTACTACTCGGCGAACGGTTACCCGCAGCACCAGATGCacaacttgcagcagcaccaacaacaacagcagcaacagcagca
gcagatgcagatgtTATAAGCCCAGCAATGTCAAGTGCGGCTGTGTGACGGGTCTGCTTCTTGCACGTCGAGTAATTATGAGATGAGACTGACGAAGCGA
GTGCAAGCACAAGCGACTCCGAGGGCTGTCCGCACTGCTGTAATAGAGATAGAAACAACCCGCCAAGGATCGGAGCTCCTCGCGTCTTGAGGAAGCGGCA
GCGAAGTGTTTTATGCCGTCGGTTTGGGaacgtcgccttcctcccaTCCAGTTCTGATCGAGCTACTAAAGGAAGGACTGAGCTAACGCTTATTGCGGTA
TCCACATGAACGAACGAACACGTTTTGTCTTGAACCTTGAAGTCCGTCGTTGTCTATCTCTCCTCCCGAGTTGTCCATGCTTGCACCGCGGCACCACCGA
CATCTTGGTGTCTTCCACGGTGCAGAAGCCTGCACGCCGCATCTCCTCCCCCTTCTCTTGACGTGTACAAGCCCGGACTGCTTTCGGTGTGGCTCTGCTC
TGCCTTGTCGAGCCAAAGGACGCAGAGACTCTGGCAGAGTCACATGGTGACTTCACATGTTACAGGACGATCAAGGGGTAGCTACATTTGCTTCTAATAT
TGCAGTCCATTGTCGCTAGGAGCTACTCCGTCTGTACTCACTGGGCGTGGAAGCTCGTCGGGCCAGCATCTCagcctcgttctcctcttcctcaaaGCTG
CTacgagctccagcttcatGTTGCAGTCTGGTTGTGAAGCTGGtggctcgtcgtcgaggCACTACGGCCGCGGGGCGTCTTCTACTGGGACTGTCTGCGG
CGGTGGGGCCTCGCACATCTTCCAGTTTGGCGTTGCGGGCCGCGCCGCCCCgtctcgactgcagcttggcctGCAGATACGTGCCGATGGCCGACGTGGG
CAGATGCAGCGGCCCGGGCGACGAGACCCGCGGCGACCCGGCCTCTTGGTTGTCGTCCAGAGCCACGCGGAAGCTGCCTTTGCCCGCGTAGTACTGTCGA
TAGCACTCGATGAGCTCGTGTTCCATCCCCGCGTACgtctccagaagctgcgcggCCGACGCCTCATTGCCCGGTTCGTACACGCGCAATagccgctcca
gctccgtcttgTACTCGCGCTGGTTGTCGCCTCTGCTGGTGTCTacgtcgctggagctttGCGGGCGCATTTTCGGTCggtggatggagctgccggaTCT
CGAAGAAGCGTAAATGGACGCCTTGAGCTCTTTGCTTTTGGGTCAGTTCTATAATTCGAAACGGCTTTTTTTCCATCGACTTGAGCTTCAACTAGACCAT
GCAAGAGGCTCTGGAATCACCACCAGGCTACGGAGAAGCACATGGATCTAATGTCTAGAAGACGAGATTTTAAGACTCGAAAGCCCAAAGAGACTTGGCT
CTCAGTGAACGGATTGTGGGATGTACTCACTCAGTCACTCTTAAGATTCTGCTGGGCTGGGGCTTCGTGGAGCAACGTCTGGAAGCATCGGGTGAGCGTA
GCGATTCCAGTCCGCAGTCCTTCGTCACGCTTGGGAGAAGGTTGGTGGGTAACGTGGGCAAAATCGATGAGACGGATGTCGGCATTGCAGGCCTCTGCCA
CGGTTttgtcgttctcctcgccgTCGTACAAAAAgaggaaggagctggcgatgAACTCCATCCCTTGCTGCTCATCGAACCACGCCTTCAACTGGTCGAG
ACGCCGCAAAAACTGAATGCAGCGAATAGCAGACCGCAAAACGCAAGAAAGAGCGCGTCAGCTATACCAGATAACGTATCACGCATAAACAATCGATCAT
TGAGTCAGGAAACTCAccgcttccagcagcttggcagTCTTGGCCGCGTCTTCTGGGAAATATTTACGGAAGGCTGGAGCGAGTTCTTCCACCGAGGTGA
TACTACGGCCGAAATGCTTGTCAAACTCAACGTAGCTGCTCAGCTTCGGGTCGAATACCTTAAATCCCTGAATACGAAACCCAGTTGTCTCCTGCAACGG
GAACTTGGACTTCTCGTAcgcgatcttctcggccgacGCATTGTTTTCGTAAGACCGAGTGCCCATTTTGACGTCCATAATGCACGGCCACTGTCTCCCC
CACGTCAAGTCCTCCAATGCCAAATACTCtacacacaacaacaacaacaataacaaTAAGACCTTCATCTAATCCAGCCATTAGCGCCTACTACTTACTC
CCTGGGTGCAGTCCATTGACCAAAGTCTCCTCTTTTCCATCCTTCGCCTCAGGGACCACTACCGTGCCGTAATAACGTGGTACAAACTCCCTAAGAGCTG
TAAAATCCGGCGAATCTTTTTCCGATACAAACGCGCGCTCGTAGAAGTCGCGTTCGCGTTCTCCTCGCTGGTTGCTCTGGAAAGGTTTCAAAATGCGTCC
GTTGTGAGCTTTCATGCCTAGTTCGTAGCAGCCATATCCACACGTCTTAGAATAATATAAAATATACATCAACTACAGGGATGCATTGCAATTTTGGACG
ACGTATTACTCGACGTGTGGCCGCCCACTTGGTGCGGCATCTCCACGAAGCCCTTCTGCATGTCTGTCATCTTGATCGTaatttattttattttttttgg
ATTTTATTTCTCGAATCAGATATTTTAGAATCAGATTGTGGCACATTGGACAAGCATGGCGCGTGTGCTAGTGCTGGGTGGGACGAGTTACGTGGCGCAG
TTTGTattgcagcgtctgcagcaggacgagacgCTTCGGTCGGCAGCGGAAGAGAGAAATGCAGTGGCGTGCACTATCCGCAGCAAGCCGTTCGCTCCAC
TACCACCAGGTTTTGTGACTGCGGAGTCAGATTCCGAAGTGAAGTCGAATGGTTCTGTGCGTGTGTACTGGCAAGTGGATgtgctggatgtggaggCTCT
GGATAATTGCATTAAAGACTTCCACCCGACGGTGGTTATCAATTGCACAGGTAAAGTTTGTGATAATGAGTGCAAACTATTTTTTTCTTACTGATCTTTG
TTCCACGTTGTGTCATGCAGCGATCTCGTCACCTGCAGTTTGTCAGAAGGACCCGGAGAAGGTAGCCACTGTTAATGAGGTATTGAGTCTAGCTGATTTT
TTTAAGCGTATCGGGTCATTTCTGACGTTGGTTTGTGTACTTCGGACACAGCCTCATGGCTTGGTGTCACTGCTACAAAAATTGGAGTGGCCTGTTCGCT
TCGTGCATTTGTCGACCGATTTTGTCTATGAAGGAACTCGGCCTCGGGGAGAAAATTATgaggaagatgctgcggTGATGTCGTCCGAGTTGTCAGTGTA
TGGTGCCAGCAAACTGCGTTTTGATAATTTCCTGCTCGAGCACGACAGCTCGGAAAATTTGCAAGTGCTGGTTCTTCGCATTGCAAACGTCGTtggtcct
gcagctccactgTTTCCGGACAACAGTGCACCAAAGTTCATGGAATGGCTTCATCGCCAGCTATTCCACCCTGAGAATGCTGATACACCTCTGAACCTGT
GGAGTGACGAATTTCGCTCGTATCTCTACATTCTGGACTTAGTCGCTGTCATGTTCAAAATGCTGGCGATCGACACTCAAGCTCGCGTTACACTTGTCAA
CGTTGGTACGTACGTGTGCGTGCAGGACTGTAAACTTCTGTGGCTAAATCCTCTAATGCGATGCAGGTGGTGTGGAGGCACTTTCACGTGTGGAACTCGC
TCATAAGTACCTCGCTGCTTGTGCAAAGCGCAATCCCAAGGCTGCGGATGCAGTAACAAGAGAGATTGTGCCAACCTTGCGGGCCCAAGTAGACTTGGGG
TATACCTCACCGCTCAACACGAAGCTCAGAACAGCACGCCTTGCCAGTCTACTGTCTGACTTCATATGGACACCGACGGACAAGTTCCTAGACGAGATCA
GTTGCAGGTTTTTTGCTTGAAATGTTATTCATTGAAAGCATTACTCAGCTGTAGTTGTTCACACTGGGGGATAAGAGAAAATGAGCAGGACGATGTCAAC
AAGTAGTCGCCACAAGACAAGAGAGTGCGCGCCCCATTCGCGCTGATGAAGTCGGGTTCTCCAGTTACTGGATCTCCATCATGTTTCCCATGCTCTGTCG
CGCCTTCTCGAAAGCTTGCACGATGGGGTCCTCAtcgctgctcgacgttgGCGAAAAGACGAAGTCCGCGTCGCACATGGCAACAGCGTAGCATGCTTCG
CTGGGACTCTTGCCCTCACGCATAAGCGACACCAGCTCGTCAAACTTGGAGGTCAGAACGTCACAGCGAGCGCGCGGTGGCAGGATCGTGCACATCGTTT
CAAGCGTCACCTTCGCCTCgcgcagcgccgtctcgcTGTCCATCGCATGCTCCAAGAGATAAGCAGTAGACTCGCAGAACAAGCATCCCACCGACATCGA
CTTCTCCTTcggcgcctcctccactgcgGCAGGACCGCACGCTGCGATTCGCGTGCAGATAGTATCCACGTCTTCATTCTGCTTCAGCGAGTCAATGATC
GCGTCTTGGTGCTTCATCAGAAGCTCGCACTGTTTCCCATAACAACCAATGTTAGACTCATTGAACCATGGCACCCATACAACATCCATTCTTACCTCGC
TCGACTCGGGGATCAAGCGGCACACAGAGTCGATTGCGCGCTCGAACGTGGCTAAGCTGTCTGGTCGGGTGATCAAAGATGCGAGCAGCAGTGTGTTCTG
TTGGCAAGTCGTGCACCTCGAAGGCAGGAAATCCGCGCCTGTGAAGTCAAGTAGGCCTGACATCAGCTCGCTTGGAGCTTCAAAGGCTGTGCAGAACTTC
AGCGCCTGGCAAATCTCTTGAGGCTCCTTTCCAGATTGTAGGCCGGTCACTGCTTCATCAAACATCTTGAGATCATTGTGGCACTACGTAATACAAACAA
CAATGACGCATCGTCAGTGTAGTCTAGTCTTAGTTCGAACCATCGCGTCACGTTACGTACCGTGTCATCAGCAGGAAGTAGCTGGCACACgatgccagca
gcttcacgcatTTCCTTGACTTGGTCCGGCTTTTGAGCAAGTGCATACTTTAGCACAGTAACAACACCGCTGCAGTATGCACACGTGCTGCCACCCTGAA
CATTGTTCTGAACAGCGATGATTTCGGGAACCGCCAGCTTAGCCATAGCAGGATTGGTGTCCACCGTGCAGTACTGCAGATCGTGGCAAATTGCCTTTGG
CTGCTCGCCCTTCTGGAGAGAATCCACCACAGTGTCGAATTGCTTCACAAACGAGTGGCACTGCAAATGTATACCACACACAGAGAGAATGTTAGCACAA
CTACATCttggagaacgagaacagGGATTAACAGTCGTACCTGATTGTCGCTCGGGAGCATACCGCAAACGACGTCGGCAATTTGACGGATTTGAGCAAT
CTTACTTGGGTCTTCAGCCACGGCTACCCCAATGACAGATGCCACTTgggtgcagaagaagcaacCGTCAATGGACATTTCCATCGAATCCTTCACCATT
TGCAATAGGACCGGGTCGTACAGTGACAAATCATTACTCGAAGGCGACAAAGCAACTGCAGGTGCAGGCAACGCATCCTTAGGCGAGCAATACTTCATCG
ACACGCAGATAGCGCGAGGGTGCGTTCCGTTTTTGAGAGAATCCAAAACAAAGTCGAGCTTTGCAACGTATGGCTGGCATCCAGATTCTTCGCCCATGAG
CGCGCAAGCAGTGTCTGCCAGTTGCTTGATCTGTTCAATCTTCGTAGCATCTTGTTCGTAAGCAGTTTGCACGAGCGTGGTCGCATATTCGCAGAGGAAA
CACGTCTTGGCGTCAGTCTCGGCAGCCTCAGGACGACTAGCGATAACCAGGGCTGATACAGTGTCAGCGAAAGAATATTCGTCTGATATCACgtccactt
tcttcttgcaaAGACCGATGGCCTGGCAGATTTCGTGTGGGCGTTTgccctccttctccagttcaACAATTTTGTCGAAGTTTGTGTCCACTTCATCGCA
CTTGCAGTCAGGGCTTGCTAGCTTGCACACATTCGTCAAAATTGTCTTCACAACCGGAAGCTTCTCCGGCGCTGTCTTGTTAACGTGGTGAATAGCAATG
CCAACGTGAATACAGAAAGAGCACCCGCGGTCGTGCGGTCGGTGCTCTTTGGAGCTCAAGGCCACTGCATTCtcttcaccatcagcaaTAGCCAGCGACT
CTTCCATCGCAGCGCAAAACTTCAACTCGGTGCAAATTGCCTTGGAGCTCATGCCCTTGGTGATCGCATCAATCACGAAATCGAACTGCTTGACGTACAC
ATGGCACGGGTTTTCGGCCCCCAGCATATCACAGATCATATCTGCGTAGGTGCGGATTTGACGGATGTCTGTGCCGTACTGCTGAAGTGCAATTTTGGCC
ACTGTGGTAGCGAACTGGCAGTACGTGCACTGAGTCTCATTTCCAGGAGGCCACTGCGAGGCCACAACGACGCCCTTCATTTCATCGGCAATTGAAGGTG
CACCATCCTCCCAGCCCTGTGTCTTGTTGCAAACTCCGAGTGACTTACAGATCTCGTGCGGGTGCTTgccttccttctccagctctaCAATCTTGTCGAA
GTTCTTGTCCACAACATCACATTGTAATTTTGAAGGCACCAACTGGCACACGTTCGTCAAAATGGTCTTCACGATAGGCAACTTTTCCGGAGACGTGTGG
TTGACATGGTGGATCACCTTGGCTACACgtgagcagaagaagcaactGCCATGCGGGCGGGGACACGGGCGAGGAGGGTGCAGCGGATATTCAGCATCTt
gcatcatcgccatctcGCCACGTCTACCGTGTCCTCGGAGTCCATGGCGACCGCCAGGTCCCATCAAaccgacgtggtggtgctttcCTCGAGGGCCATT
CCGCATCATACCGACATGAGGGTTTTCTTCCAACTGCGGGGTGTTGTCTGAGTGCTGCGCTAAGCAGTAGTTTAGGGCCTTGCAAATATCACGGGGGTGT
ACTcccttcttcaaggagtCAATCACCGTGTCAATTTGGTTAACATACTGATGGCACGGGCTGTCGTCTCCCAGCATGCCGCAGATCATGTCAGCATAGT
CGCGAATCTGGTCAACTTGCTCGGGAGACTCTTGCAAAATAACCTCCACCACAGTAGTGGCCGCGTCGCAGTACACACACGTTTTATCACCGCCACGCAT
GTGATCCATTGGTTGCATTTCACCGCTAACCTCCTTGGGGCAGAAATCAGTGCTAGCACAGATCTCACGCGGGTGTTGCCCTttctgcaccagctccaca
atACGATCGAAGTTctcttccacttcttgaCACTTGGATTCCAATGAAGCCATCTGACATACTGTTCCCAACACCGACTTGAGCATCGGAAGCTGTTCGG
GGAACAATTTGTTCACTTGGTAGATCACACCAGCCACACGAGAGCAGAAGACGCACGATTGGTCGTCCTCAACAAAGTCTGAAGATGTAACCAGAGCTCC
ACCTTCAACCGTTTTAGGCTCTTCAGGGGTCCACGGCAGATCCAAAACCTGCTTGTCGCTTCCACTGCCCGCCGTGCACATGGCGATCCGCGAGCACACC
ACCAACGGATCCGTGCCGTGCTTGAGCCAGTCCACAATAGTGTCGAAGTTTTTCAGGAACGTGTGGCACATGGAGTCGGCCGCCATCGCGTCGCACAAGT
CTCCGATGATCGCACggacctgctgcacctgctgcattTGATCAATCAGCGCTTGGTCCACCATCTGCACGAATCTCTGGCACAACTTGCACGACAAGTC
GTCGCTTCCTTCCAGGTCCGTCACTGCCGCCATGACGTCGCacacctcgtcgtccgtcttgcCCTCCATCAGAAACTTCTTCACCACATCTTCCGACTGC
AACACCACATTACACTACAACACACACGAAATAACTCACAGTTAATTAGTTCCTGCCAACAATTAATTGCATTCCATCGTCGCACCTGTTCAACCAGCTC
CGGCCGTCCCAGATCTTCACACGACGTCTGTCCCCAGACCTGCAGCGAAACCACATCGAAGGCCGATCGGAAATACTGCAATAGCGtctccgtctgctgc
tgcagctcgtcctgctggtggatcgtctccagcgccttcagaCACGCCAGTTTCCGCTCCAGCGCGGGGTCTCTCTCCTCCCCCTGCTCTTCGAtcacga
cgacgcgcacgACGTCATCGTTTGCGAAGCTGAAcagccgctggagctgcgcgttCAACAGCGTCATgagaccatcactctcgtCTTCGTAGGCGGCGCT
TGTGGAGGCCGacagactcagcagcagcgcgtgcgcGAGCCGcattcttctccttgaggcttcttgggcttcttcaaGCTGGGGCGAATCCTAATTTGAA
GGGAAGAACCGTGTGACTCCGAAAGAGAGGACGGATGTCATGGATGAACAGAGGCCCCACCCTTGGCTGCTTTGGAGGTAAAGGAGAGATGTTGGTCGGG
AAAGCAGTCTGATACCGGTGTTGTGAGTGGGAAGATGCATGGGGATCAGATGGAGAAAGGGGGGTCGACTATATTGATTTGGTCGTGGAAAGAAAGCTGG
TCAACGCgcttgttgaagctgtccagccaatcagattTGGCATCAACGGACGTCAGTTTACCTTTTTGTGTTCTTAGCTTACCGTAAAGAGATCTATCTA
TCTTAACTAACGTTGATCTTTGCGATGAGCTGCAAACTCCCACCTTGTCTAGATCGAGGcatccacagcaacaatGAGCCGCCTCCCGTACCAGGAAGCC
CCAGAAACCCCGGACGCCATCGATCCAGATACAACGTTTTACCTTCCAGTGCCGTCACGATCGACACCCACTTCACTGTACCTCCTGCTGGAACATCCAC
CTCGCCAATCTTGTGTCCACCCGACTTGATATTAACAGTCACGTCTTCAGTATCAACACTCTTGAACGTGATCTCGACCTTGCCATCTCCGACCTTGGTC
CAATTCCCATTGCTGCCTTTAAAAGCCTCCCCAACTGTCCTCAGCCCCAGTGCGTCTTTTGCACTCCCGTCGTCGATCTCACCAGTGAATTTTGTTGGTC
CGCAGATAGTCTGGAAGTACTCGGTGACAACGTGACCGATGCTGGTTAGATCCCAAACAGCGTAGAAAGAGAGCGCTTTGTCGGCGATCTGGTACGCGTA
CTTCTCAGCTGATAGTAGCGTCCCATTCTTACTGGTACTTGACCGAATCAAGTCCTCCATGATGCCTCCGAAAGTCTTGCGGAGTGTGTCACGTGTTGTG
TACGCTGTCATCTCATCTGAATCGTCGATCAGTTCTtccatgcagttgttggtcGCGATAGGGATCTCGCTGAGGACGAGGCTCACCTTGCTCATTTCCA
CGCGAATGTCGGATTCAGAGATCGCTGGATTCTGCTTACGCAGGTCTGCCACGGTCATCCACGTACGGTCTAGTAGACGCTTTATGTTGTAGCCGCAAGT
TGATTTGGACTTCAATGCCGACTGCAGCGAGGTGATGTCAGACGCGTCTAACGATTCCATCGGCTCGTCCAGTGTGATTCTCTTCATGAACGCCTTGAAC
GCGGTCCAGCTGGCGAGGATAGCGCCGCCGTCGGTCGCTATTTCCTTCACGAAGAGCTCTATGGTGTTGGTCACTCTGTCTGCCGTCCTGATGCTCTCGG
ACACGGGCAAACCCAGACACGTACAGATTGTGACAGGCAAGTCGAAGACCACGTTGTCGGTTTGGTACAGAACCGCCTCAAGATATTTTACTGTGGCGTG
AGGATGGAATACTTTGACGGTGCGGACAAACTTGGTCAATTGCCTCACCAGATTCATCATCTCTTTGCCGCATCTGTACACGACCTTCACGCCTTGCGCC
ATTAACTTGAACTCTCCGTACAAGCCGAATGTGGCGAGGGAAAACGTGGCTTGTGCGACGACGGACACTTTGGACACGACTTCAAGTGCACAGTCATCGT
TTTGTCTGATGCACTCCATTCCACATTGGACAGGATACGAAAGTGGACATTCGGCCCAGCAAATATCGTGGTGGTTGTCGAATTCTAGCGGGCATGATTT
CGCAATATGGGCTTCGCGGTAGCACGCGGTGTCGGGCGCACGACCGAGTGAGGGACCGACCCAGTTTTTGTAAGTAGACTCCATCGTAGAGATAACTACT
CCACCCGTTGACCCGGATGCCATGTCGGAAGTCGCAGATTCTGACCCATCGTCGAAACTGTCTGAAGACTCATTATCGTCATCGGAGTCGAgattttctt
tttcttcgtcgtcgtgtttGCCGGTGTCAGCAGGCTTTTTGCCATCACTGTCAGAAGATACTTCGAGGCTTGATGATTTGGATCTAGAGACAGCATTTTC
CGGGATGGATATGGTTGTGTTTGGTGCGGAGGTTGTGCCATTGCTGAAATTATAAGTCTGTGCGGAAGAAGACACGATACCTGCGCTGAGCAGAGTGATA
ACTTGGATCCACTTGAACACCATTATTGGCCAAACGGTTGTTAAAGTGACGaaaaaatgaagaatgaacTCCGACCTCCTGTGGGCTCACGCTGTTCGTA
AAACGATCTCCCCACCGTGCAGCCGTCGTCGGGTAAGGCCACTGCACCAGAAACAAAAGCTATCCGGAGACGCAGAATTGCGTCGACGATCAACAAAGTA
TGAACGTGGACTATCCTCTTGGTCAACGTTTGGCCCTACGCGTCCTGGAAATTCGATGTTGTCGTCAATTCCGGTGCAGAACCCAAGCGGCAAGATAATT
CCCTCGCATCAGTTGAGCTTCGCTCAGTTGTACGACCAGCAGTGACTAACTGCAGCCACCATTAATACCCAAGACCCAGCATATTACTGCGACAGCCATT
GATCGACTGGGGCCAGGCAGCGATTACTTGTTGTCTGTTACGTTGTGAAGCAATGCAGTCCGTCCCGGTGCAAAAAGACGCAAACTTCAGGATTGGGATT
TCACGATGTGAGCTAACCCTTTGGTTGCTAGTCGCACCCTTGTACCCGTCTCACACTGCGTGAATGCTATAAAGACGAAGCCACAGCCGTATACAGCTTT
GTTTGTCGCGAAGCCGGCGCATTTCCAACTCGTTTGCACTTTACCTTACAGCATTGATTTCCGCAGAAATTGATACTTTTTTCTAATCAACTGCCCTCCA
ACTTGCAGGCAACTCGACGGGAAACTTTGATTAGAAATTGTTTACCGTTCCCGAACCTTACCTCTCCCGTCATTTCGTTTATCCTGTTTTCGGCTGAGAC
GTGCCCAGCGTGCCTGTCTTATGCGAGCAAAGCTCATACGCGAGGTGAAAAAAACATTATTTCGCGAGACGACAGCGCCCAAGCAGCACGCATTGCGAGG
TAAACCCGCAGGAGATGTGCAAGCAAAATTAACCACCAAACAATGCTACACTCATGCGTCCTATCAACGCGAACGGAGCTACAATACCACCACGGGTGAA
GGGTGTTACTTTCGAGTATTCATTTGTTGGAAGTCGTAACGCTGGTCCACCAGTTTGACGGGATTCTCGATCTGCGGTTTGCCGCGTCTACGGTGGTTAA
ACTTTTACAAAACAGCATCTTTTATCGTAAGCGTATTTTACGACCCATCTTACAGCGAGCTCGAGCTATTCTTCGAAGTCCGAGCCTCGAACCGTGATAT
CTTGGCAACTACGCCGTAAGGTGAATTGCACAATTGGTTTATGCATATCGGGATCATTAAAGTTTACATCAAGAAAAACTTTGCTATAACAGCGCTCTGC
CAAAGGTAAGCAAATGAACAGGGAGCATCTACGAAGGAGGACCATTTCAACAATTTTTATTTACTCAGTTCTATCATAATTTATCTACTTTCGCTATTAC
TCACTACATCAAACAACAATGGAGATCTCTCTCCTCTAACACTAAAAAACTAAACTCAGCTCACATTGAGCATCGCTGTGAGTTGCAGGTTGCCGCCTTG
TTTTGCCCGCGGAACCCACAAGAGCAATGAACCACCTCCCGTACCGGGCAGACCCAAAAATCCGGGACGCCAGCGATCCAGATACAACGTCTTTCCTCCC
AGAGTCGTCACGTTCGAGGTCCACGTGACTGTTTTGCCAGATGCGACAGGTACTTCATCGATCTTGTCTCCTCCAGACTTAATGTTCACGGTAACATCCT
CGGTGTCGGTGCTCTTGAACGTAATGGTGACAGAGCCGTCGCCGACTCTGGTCCAATTGCCAGAGCTGTTGTTGAAAGCTCTCTTCACGGTCTTCAAACC
CAACGCTTCCTTGGCACTCCCATCGTCGATTTCACCAATGAACTCCGTAGGACCACAAACTGTCTGGAAGAACTCGGAAATTACACCTCCGATGTTTGCT
CGCTCCCAAACAGCGTAAAACGTTGCAAGCTTGTCGGCGATCTTGTATGCGTACTGCCCGGCCGTCAGAAGCGtgccattgttgctggtcCCTGAACTGA
TCAAGTCGTCCATGATGCCACCAAGCCCCTTGCGGAGCGTTTCTCGAGTGGTGTACGCCGCAGATTCGCTGGACTCGGCAATCAGCTCCACCATGCAGTT
ATTTGTCACGGTGGGAATATCGTACAGCGCGAGGTTCGACTTACTCATCGCAACGCGGATATCATCCTCGGAGATTCTCGGGTTTTGTCGACGCAATTCA
GCCACAGTCATCCACATTCTATCCAGCAATCGCTTCATGTCGTAACCACAGGTCGAGTTGGAATGAAGTGCCGACTCCAACGACGTAATGTCATCCTTGC
TCAGCGAGTCGATTGTATCGCCTAGGGTGATATTCTTCATGAACTGCGTGAACGCAGCCCAACTCGAGACAATAGCGGCGCCGTTTGCGAGGACTTCTTT
CACTGTGAGCTCAACGGTGTTCACCAATCTGTCCGCGAACTTGAACTGCTCGTCCACTTTGATGCCTAGACACGACATAACCGTCACGGGGATGTCGAAG
ACCACATTGTCTGTCTGGTACAACATTGTTAGCAATTTGTCCTGGGAAGTCTGCGGGTCAGATACTTCAACAGTGCGAACGTACTTGGACAAGCTCTTCA
CCAAACCCATCATCTCCTTGCCGCACTTGTAAGCAATCTGAATCCCCTTCGCCATCGCCTTGAACTGGCCGTACAAACCGTAGGTGGCCAGGGACAAAGC
TGACTGAGCCACGGCAGAAACCTTGCTCACAACCTCGAGCGCGCAGTCGTCGTTCTGTCGGATGCACTCGAGTCCACACTCGACCGGGTAGGAAAATGGG
CACTGCGCCCAGCACGTTCCAAGCTTACCATCGAATCCCAGAGGACACGTCTTGGCGATGTGAGCTTCACGATAACAAGCCGTATCCTTGGCAGTACCGA
GAGCGGTGCCGATCCAGTTCTTGTACGTCGACTTGATCgtgctggtggcgttgaGGGCGTTGCCAAGTAAGGACGCCAAGTCGTCGGAGGAGTCACtctc
gtcgttgctgtcggaagagtcgtcgtcgctgtctgaGGAATCCTTATCGTCGTCGCGAATCGATCGCTCTTCGCTGTCCCCAACCGATACGAACGAAGCT
CTTGTCGTATTGAAAGTCGTTGCTGTACCATTTACCGTGAAATTGGCAGCGACCACAGTTGCGcttggtactgctgctgcagttttgttAAATGTGTAGT
AGTGCGCCGACGAAGTTGCACACAAGACCGCCGCGAATACGAGGGTCAGTACCAGCAATACCCTGGTCATTCTGCGAGGCAGCCGGCCTCGAGCAGTAAA
AATGGAGAATGGGTTTGCCGTTTAACCAAACCGCCAAAACTGAAAGCTTACGCCTCTTTTACGAGCGTCCGCGGCAAGACAGACCATGCTGCATGTTGTG
ACCGTCTCAATCCAGATTCGCGGTGGTCGTGAACGCCGGGCGGCCAACACAACCCCCAATCTTTGGACGTGTATCGAATCTGCCGTTCCGGCGCGACAAC
GAATCTAGCGCAGCGGAGACAGATCAGGGGTGGACGGCGACAGGCGCTCCTCCAGTCGTCGGTGTCTGCTCCACTGTTGTCAACACCAATGTGGCGTTGG
CTAACGCATTTTGCCATGACCATCTGGGTGATACAAAGTATCTCAAACTCGAGAACTGTGAGTGGGGCTGCATCGAGGATTCCGTTGGCTAGCGCTAAAG
CTTGCCGAGAATCTACAGGCTGGACATCCCGTGACGGGGATATTGAGCAGGATTGGGCGTGCAGACCATAGATGAGGCCGCAGTCTTAGCTCGAGTGTCG
ATTCTATTTGCTCACCTCAGATTCAAGGTCGAAGTTGCCACTTGGACCTGCTTCAATCGTCAATGGTGCTTCGTTCGTGTGTGTACCTCTCGCAGCTGCA
GTTTCGCTGCCTGGCTGGCGGGAAATACAGTCATGACAACCGTCTCAAACTCATCAATCGTCCCTCACAACTCGACGGTTAGATTGGACAAACAGCGAAA
CAGTGAATCTAAGATCGTATCTACCATTTCGCTAGAGGCCAGCCTTCGTCAATCCCTGAACTGCTGGgcttgcagcaatttctAGACCGCCGTCTTGTCT
TTTTAGGCTGCATCACGTGATCGCATCGCCTTGTTCTCGTTGCGCTCGACCCAGCGTTGTAAAATTGCCACACCCTCACGACATCGCTGCTCACCTGTCG
ACAGCGACTTGTTACCGGTCCACAACTTAGAAAGCAACCTCTTTCCATCTTGACATGGCGGTGGTTGCTCAAATGTACCTCTAGACGGTCTAAAATACAG
GCCTTCGGTCTGCGACCAGGTCATCCAACAGCTTGTTTAGACGCAGCCACTTTGTTCCTTAGTGTGCGCAAATACTCGCGTCGCGACTCCTCGTCCCTGT
AGTGGATTGACCGAACTTTTTCTCCTTCGTATCCGCACTGCGGCGTCATTTTGATgaattcttcttcatcatccatgGACGTATCCTCGACACCGCAACT
ATTAGATTCATCCGATCGCTCGTACGAAAGCGCGTCCATTTCATGAGCGAGCAGGAATTCATGGATCTCTACAATCTTCCCTTGCTCCCGTGAAAAGCTT
GCATTTTGTATCTGTACAGAATTGAAAGCATTTTCAAACGCACGCTGGAACTTCTTTGACGATAGTGGCAGTGGAAACAGCGACTCCATTGCTTCACTGC
CCACGCCAGTAGCAGCCGGATCCAAGACAGTGATCACCGGCACCAATGCCGTCTTGTGTGGGAAATAGTCGCAGTGCTGTGGGACATTAACCTGCACTCT
TGAGGCTGTAACTTTACACCCGGGACGCTGCAAATTAAGCTCTCGTGCCAAATACCCGGTGATGCGAGCACCAGTCGCACAGTGCTTCAATACCACATCC
AGAAAGTCATGCCACCGCGACCTACCAACAATTATCCAGCAAACCCCTTAGTACACCATGACTCCCTTTTCTCCATAACTTTCACCTTATCGACTCACCG
CTGCCAACAGTTGACCCCTTCACCACCCCCTGTTTCCAATTCCGGAAGCGGGTAGTCGTCGAAAAAGACGCAGTCGAATTGGTCCAACGTgggcaactgc
tgctgccacgttCCTGACACAATTTCGACCCCGTTGTGGCTTACTGCAAACTGCCGAGCGCGTTGCAGCACCTCCTGATCGCATTCGATGATCGTGTGGC
TTTTGGGACGGAACGTCTGGATGTGGGAGGCCGAATAGGCCAATCCAAAGCCGATTTCCAGCACGCGGTCCGTCGGTTGGATGGCGAGAGCGTCCACGCA
CAGCTCCATGTACTGCTTCTCCCACTGCATCATCACCTGCTGCCCCTGGGAGCTCCAAAGCACCTCCTGCCCGAGTTCATCGAGTCCCTTGACGTTGCCC
TTTGTGGTCAT