Description :
From Genome Similarity Track
Location :
Scaffold_2308:63- 3072
Sequence
3009 bases(100 bases per row)
CTTCCCGACAAAGGCCAGTGGAAGAGTGCTATCACATCTTCGAATAGCGAGAACGGGTTTTCCCCGATCAAGGCATCTTGTGTCCACCTGGAAACAGTTG
CCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACCGCCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATAAGA
CCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTTTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGA
TTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGTGACGGAGTATGCGGACGTGGTGAATAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTA
CGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGGCTTCTTCGCCG
CGAAAGCAAAGGCAGGAATGGTGCGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGC
TTATAACAAGCTGAACGACGCAACGGTGCCGGCCCAAACACCGATCCGACGAAATGATGTGTTGTTGAACAACATGGCTGGGAGCGTACTGTACAGTGCG
CTGGATTTGGTAGATGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGGAGTGGCTC
GTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGCTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTTCGAC
GACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGAAGGTGCATCTAGGGACACCTTCGTCGAGTGTTGGACGTGATGCGAGCGAACAAG
CTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTCAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGG
TCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTGGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGC
GGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTC
CAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACG
ACACGGCTGGACGGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAA
ATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCAC
CTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGATGCCCTCT
CTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCC
TATCGTCAAGTTCATTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTC
CTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCT
CCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATG
TGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTC
ATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTG
TTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCAGAGACGATTGTCTCGGATCGAGACCCGCGGTTCACTGC
TGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAGCTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCAT
GTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTCCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACG
CGTTCACGGGTTTCACGCCGTTCTTCTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGG
AGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATAGTC
AGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACT
TAGTGTTGCTAGACACGAGGAACCTATCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGGCCTTTTGCAGTCCTGGC
CAGACATGG