Description :
From Genome Similarity Track
Location :
Scaffold_55:62995- 64312
Sequence
1317 bases(100 bases per row)
GATGGTACGGGCGGAGACGACCGACATAAACCGTAGGATGCGTACGCATCCTGCGAGGCAACTCGATCGTGTACGCATTGTCTTTGCGACGTAGTCCACG
GAACAGGCCAATGTACTTCGGTAGTAGTCTGCTTCTACTCATATTAGTTATTACGTGCTTAGGTATATTTACCGTAGCCAGTAGAACTAAGTCTCCGACA
TTAAATAGAAGAACGTTTGCTCTTCCATATTTGTCAGCATTCCGTTTCTGTCGGTCCACCACGTTAGCGATGGAGTCTTGCACAAAACGGACCACTGCTT
CTTGTGCTAGCAAGAAATCTTCTGCTGCATCACTTTGGTTTGTTGCAGTGCGCCTTGTGCGCACCGCTAGGAGGTCATCCTCATCTGGGTTAGAAATAGT
GTTATCACTATTGATAAGGTTATCTTCTTCGATGTCGACTTGATCGACATCGGCAACGTTCGCGTCGTCGATTACATCGACACGTGATGAGCAAGAGCCA
GAACGGTTGTTGATAGAGCGAATCCTTCCTTCCTTGAAGTAGTGTCACACCCTAAATGGGTGGGAAGGCGGGGATCGCGTAAGCCATTCACGAAGAATGG
TGTACGAGTTGTAGATGCATGCACTGAGTTGTTGATTACAAACTTCACCATCGGCAAAAATTCGCTCCAATCTGTGAAAGATTGGATGTATCCTCGAAGT
ATCTCTTTGAGGACGCGGTTGACGCGTTCTGTCTGACCAACAGTCTCGGGATGGTCAGAAGTAGACATAGTCAGACGTGTTCCGAGGGATCGGAACACGG
ATTGCCAAAACGTCGCCGTGAACCGAGGATCTCTATCAGAGACTAGTTCACGGGGTAGACCGTGGAGTCGGAATACCGTGTCAATGAAGACGTGGGCAAA
GCCATGTGCTGAGATTGACTCATTAACTGCAGCAAGATGGTACATCTTGCTGATTGGTCTGCGAACACAAGAATACCATTATTATTGTGAGCGTCTTCGG
GAAAACCGAAGGCGAAGTCCATTGAAACGGACTGCCAGCACTCTGCCAGGATGGTAGAGGCTGTAGTGGTGCACGGGATGAACGACCAGGCTTCACCCTT
TGGCACACTTCACAAGCACGAATGTACTTGTGCACAAACTGATACTGGCGGGGCCAATAAAAGTCGCGACTTACCGTGAGATAAGTCTTTCACGCCCATG
ATGCCCACTAGTTGGTGAATCGTGGCACTCATACATGATGCGTTAGAGCAACTCATTATGAGTGGGGAAGACGACACGAGGTGTGTCGCTGGTAACGGCT
TTATAATACAGCAAACC