Description :
From Genome Similarity Track
Location :
contig_60:62994- 67041
Transcript NameFunction/comments
g11141.t1hypothetical protein

Sequence
4047 bases(100 bases per row)
CCCGCAGGTCAGCCAGCCTCGGTGCCTCCAAGGCCTTGGTGAGGACGTCTGCTGGCATCTTCTCGCTCTCGAGGTACTCGGCCTTGAGCACTCTCCGCGC
TTCGCAAGCGCGCCCACGAACTTGATGCGCACATCAATGTGCTTCGCCTTGCTCGATGAGCCTTCACCGTCGAGCTGCTTGAGCGCCGCTTGATTGTCGA
CGCGCAGCGACATCGGGCTGGCATGCGTGACGCCCAGCTCGCCAAGCAACTCGCGCACGCCCAGCAACTCCGTAGCCATAACCGAGGCTGCAGTGTACTC
GGCCTCCATGGTGGAGAGGCTGACGCCGGTCTGCTTCTTGCAGATCCACGACACGGGCATCCCGTCAACCGTGAGCATGCCGCCGGTCACGGACTTCCTG
TCTGCCTTGTCGGCAGCGAAGTCCGCGTCGCTGTACGCGATGACCTTCAGCAGCTCCTCCAAAGCCCCCTGGCCCTTCATGCTTAGCCGCAGGCTCTTGG
TCCCCGCCAGGTAGCGCGCGATGCGCTTGCCGAGCTTCCAGTCGGACATCGTGGGACTGTGGGTGCGTCGCGACGCTTTGTGCACCGCGTACGCGATGTC
AGGGCGCGTGCAACGCGCCACCCACATTAGACTCCCCACGAGCGACTGGAACTTGCGCACTGTCACCACGTCGTCTCCTCCAGACGTGGGCAGAAGTTCA
TCTGACGCCTCGTCGATCTCGTTCGACTCGGCGCCGATCGGGGTGCGCACGCTGTGCACTGACGCCATCCCGTGCTCGCGCAGCATCTCCTCGATGGCCA
GCTCCTGGTCGAGGTCGTAGCCCTCGTCGTCGTTGTACGACACTCTCATGCCGAGGAACTTGCTGGCGGGGCCGAGGTCCTTGATGGAGAGCTCGGTCAG
CTCACCGAAGAACGCGTCGACGGCTTGCTGCTCCATTCCCGTGACCAGCAGGTCGTCGACGTACACGCCGACAACCACCAGGACGCCTTCTCGGCGCCTG
TAGTACACGCACATGTCCGTCAGACTCTGGGCGAAGCCCAACTTGATGAGAGTCTTGTGCAAGAGCTGGTTCCAGAGACGGCCGGCCTGCTTGAGGCCGT
ACAGGGCCTTCAACAACTCCAGCACCAACTCGGAGTCGTTCGCGACACCCAGACGCTTGCGCACGTCCTCCGGAATCACCATCCCGCGCGGCAGGCGCAG
GAAGATGTCCAGCTCGGCCTCCTTGTCGGCCTTGACGTACGCGTTGGGCACGTCGCCGTGCTTCGCGGGGACACGCCACTTCCTGGCGAGCACGAAGATC
AGCTTCACGCTGCTCATCTCGATCACAGCGGAGAACGTCACGCTGTAGTCGACCCCGAACTCCTGCTCGTTGCCGCAGGCGACGAGTCGCGCTTTCAGTC
GCTCGATGGCGCCCTCCGCATCCATCTTGGTCTTGTAGACCCACTTCGTGTGGAGCGCGTGGGCGCCCTTGGGCTTGCGCACGACTCGCCAGACCCCGTT
GTCCTCTAGAGCTCGCAGCTCCTCGGCCATCGCGGCAAGCCACTTGTCCTTGAGCTTGCTGCGCATGGCCTCCTGGTACGACTTCGGGTCGTGCTCAGTG
ACGCTGTTCACGATGTCGCGCGCCGCCTCCTGCGACTGCGCGGTCTCGTTCGTCACGCCGCCGGCGTTCTTAGCCACAGAGCGCGTCATGTGGCGCTCGC
GCGCCCACGGCTTCTTCTTCTTGGACGCACGCTTCTTCTTGCTGCGCGCGCTCGTGGCCTCGGCCACCGACGCTTGAGCCTCGCTCACCGGCGCCTCGGC
GCCCTCGAGCGTCTCGTCGCCTTGCAGGTAGAGCCTCTGAACCTGCAGGTTCTGCTCTTTATCGAGCGTCTCGATATTCTTGATGTGCTGCGTGATCACC
ACCACCCTGTCCTTGGGCAAGTACACTCGGTACCCCTTGGTCTCTTCGCCCACGCCCACGATCATGGCCGTCTGCGCGCGCTGCGCGAAGTTCTTCTTGC
GCGGGTCGCGGTACACGCTGCACGGCGACCCGAACACCACGATCTCGCCGAGCGGCGGAGACTTGCCCGTCAGCACCTTCAACGGCGACGCACGCCCTGG
GTTGGAGTTGGTCGGGGCGCGGTTCAGAATGTACGCGGCGTACTGAACCGCGTCACCCCAGAACCTCAGCGGAAGCCCGCACGCGAAGATCATGCACCGC
GCCATGTTCATGATGGTGCGGTGCATGCGCTCGGCCTTGCCGTTGCTAGATTGGTTCCGCGCCTCACTGCGCTGCCTGGCCACGCCCGTGCGCTTGCAGA
ACAAGTCCACGTTCTCGTACTCTCCTCCGGAGTCGGTGCGCAGAACGTGGATCTTGCAGTCAAACTCCTTCTCGAAGTAGACTAGGAAGTGCTCGAAGAG
CTTCGCCGCCGCGTCCTTGGTGCGCGCCAGGAACACGCGGCAGTAGTTGGACTTGAAGTCCACAAAGTTGATCATGTACCTGTTTCCCAGGCGGTCCTTG
GGGGTCATCGGCCCCTTCAAGTCGGAACATATCACCCCACCCACCCTGTCGATGGGTGAGTGGGCGCCGGTGTCCTTCTTGGACCGCCGGTTCTTCGTCT
GCTTGCCCTCGGCACACGTGAGACAATTGACCCGCTTGTGGTCGGTCAGGTAGATCCCGGAGCTCGGCTCCTTAGCCAGTCGCTCCACCGAGTCATAGTT
CAGGTGCGCCAAGCGCTTGTGAAACTCCAGCAGCGTGCCCTTCTGCACATCGCCCGAAACTTCCACAGGCTCCGTGAGCTCCTGGCTCAGCGCGGCCATG
ATCACGTCCGAGGGCAACTCATGCCTCGGCCCCACAGCGGCGCGCACAACCAACACGTTGCGCCGCATCTCGACGTCGAACGCCACGCGTCCACCGTCCT
TGGTCGCGACGACGCGTCGTCCGGCTTGCTGTCTCAGCTCGAAGCCACGCTTGTCAAGCTGCCCGTAGGAGATGAGATTGTGGACCACGTCCTTCGCGAA
GTACACGTTGGTGAGCTCCACCATCTGCTCCTTGCCACACGCCGTGACACTCAGCAGCACCTTGCCGCGCTTGGTGATGCTCAGCGACTCGCCGTTGGGC
TGCACACACTCGTCGCTGCAGTCATCGACCTCCTCGAGGAGCGACTCGTCGTTCACGAGGTGGCGGCTGGATCCACTGTCCAGGATCCAGAGTCCATCGA
ACTCGCCGGACTTCTCGCCGACAGCCAGCGTGATGTCCGCGCGCTGCTTGCGGTCCGGGCATGTTGCTCTCAGGTGGCCCACACGGCCGCACTCATGGCA
GCTCCGTGTCTCCTTGCGCGAGTAGCTGCCCTCTCGCACTGCGTTGACCGTCTCACGGCCTAGCGACTTCTGCTTGGTCGACTCGGTCTCCCAAGACTGC
GCGAAGTGCGCGAGCTCCTCGGCGTGCTGCAGGTAGTCGGTCCGCGACTGATCCACCTTGGCCATCAACACCGTGCGCAGCTGCGGGGAGGCGTACTGAA
CAATGTTGTTCAGCACCAAGTAGTCCGCGCTGCTCCCCGTGGCCTCGGAGATGGCCACGAGGTACATGTAGTGCTCGGGCCACGACCTCTTGGCGTCCTT
CGGCGCCGTGAACAGCTTTATGGCTTGGGCGGGCGTGATGTTGGTCTTGAACGCGTCCAGCATCCGCTCCATGACGTACTGCAAGGTGGGCAACTGGTTC
CACCAGGTGTCCACCTGCTTGTTGTAGTACCGCTCGGCCGTACCCGACAGGTAGTGGCCGAGCAGGTCTACCTTCACGTCCTCGGACCATGGGAAGCCGC
ACGCCGACTGCCCGAGCGCCACCTGCCGCTCGAACCTCCTGCCCCAGTCCAGGAAGCCGGAGCCCAGCCCGACGTACAGCTCCTTGCCGTCGAACGGGCG
GATCGCCAGCTTCTTCTGGCGAGCGTCCGGGTATCGGAGCGCCCCGCCCTGGTTCTGCTGCAGATACTGGTACTGCGTGGGGACGGCTGGCGGCTGAGCT
TCAGACTGCCGAGGTGCTGGCGTCGGTGCCGCCGGTGGCGGCTGCGC