Description :
From Genome Similarity Track
Location :
Scaffold_110:62992- 67081
Transcript NameFunction/comments
g18617.t1RAW28343.1 hypothetical protein PC110_g15282 [Phytophthora cactorum
g18618.t1hypothetical protein

Sequence
4089 bases(100 bases per row)
GTTGGGGCCCTCGGTCACGCGCACGCCGTACTCGGCCGGCACGAAGAGCTGCACGCCCGCCGCCTTGGCCGCGGGCACCAGCGACTTCTGCACGCCCATG
TTGTAGGGCGACACGGTGCTCACGACCACCTCGCTGCCGGCCAGCGCCTTGGCCACGGCGGCCTCGTCGTCGTACGCGACCTGGTGCAGCGTGGCGCCGC
GCGCCTTGAAGGCCTGCAGCTCCGGCTTGCTCTCGTCGCGCGTGAGGATGGAGACGGACACGGCGTCGCCCTTCTTGAGCAGCTCGTCCGCGACGGTGCC
GCCGACGCCGCCGGCTGCGATGATGGCGAATTTGGTGTAGGTCGACATGAGTGGGGTGGGGAGTGGGGGAGGCTTGTGTCTTGAGGAGACTTTTGAGTTG
TGAGGTCGGAGGTGCGAGGCGCGGGCCCAGCGACGGTGTGGTGGAGTCATGCAGAGTGTCGTAGCGGTGGGGTCATGGTGCTGATTGTGTCCACTGCACG
ACAGGTTAAGTGCCTTGGAGGCTAATCAGACGCTGCCTCGGCATGGTAGCTGCTGACGTACTTGAACGACTACCATAACAAAAACGTCAACAAGGGAGGT
GAATAGTAAAATACGGTATTAATATACCGTATTTAAAATAAGCTACTGGCACCTGTATTTTGAACGTTGGAACTCAAGAGAAGTCGAGAGGTTGAGTGCT
CACACATACATGTACGCTCAACCTCTATTCTTACGCAAATTAGCTTAGTGGTTGAATTGCGCCCAGGGTGCTGCACAAAGCGACTCTCCATGCATTATAC
TACTTAATTTTTACTAATTTTTAATAATAGTCGATGTTTATGTCACATTGTAATTTATAAAGGCAAGTTTTTTTCCCTCGGGACACCATTCGTCGAAGGC
ATGCGAGAACCTATCGGGGTCCAAGACGGCTCCTTGTCAAGTTGCTGCACATCGACAGCACCCGGCAGATCACGTTGATTTGATGCCCCACAAACCGAGT
TCAAGTCATCATCCTCTCCATATGTGACCCTCCCCTTGTTTACGTGTCATGGTACTCGCTTGCATTTTATTATGGTAGTCCACCATCTCCCCCGCTGATC
GTTCAAGTACGTCAGCAGCTACCATGCCGAGGCAGCGTCTGATTAGCCTCCAAGGCACTTAACCTGTCGTGCAGTGGACACAATCAGCACCATGACCCCA
CCGCTACGACACTCTGCATGACTCCACCACACCGTCGCTGGGCCCGCGCCTCGCACCTCCGACCTCACAACTCAAAAGTCTCCTCAAGACACAAGCCTCC
CCCACTCCCCACCCCACTCATGTCGACCTACACCAAATTCGCCATCATCGCAGCCGGCGGCGTCGGCGGCACCGTCGCGGACGAGCTGCTCAAGAAGGGC
GACGCCGTGTCCGTCTCCATCCTCACGCGCGACGAGAGCAAGCCGGAGCTGCAGGCCTTCAAGGCGCGCGGCGCCACGCTGCACCAGGTCGCGTACGACG
ACGAGGCCGCCGTGGCCAAGGCGCTGGCCGGCAGCGAGGTGGTCGTGAGCACCGTGTCGCCCTACAACATGGGCGTGCAGAAGTCGCTGGTGCCCGCGGC
CAAGGCGGCGGGCGTGCAGCTCTTCGTGCCGGCCGAGTACGGCGTGCGCGTGACCGAGGGCCCCAACGTGACCAAGAAGGAGGTGCAGGACCTGCTGACG
CAGCACCAGATCCCCTTCACCATCTTCTACACGGGCCTCTTCGCCGAGTTCCTGCCCTACTTCCTCGACTACCACTACGCCGACGGCTACATGAACGTGG
TGGGCAAGGGCGAGACGGCCTTCAGCATCACGGCGCGCTCGGACGTGGGCCGCTTCGTGGCGCACGTCGTGTCCACGGCGCCCAAGAGCGCGCTGGCAGG
CGCCAAGATCCCGTTCGAGGCCGAGCGCCTGTCGCCGCTGCAGATCCACGCGCTGGCGGAGAAGAAGCTCGACAAGAAGATCGAGGTGCGCCACGTGGAC
TTGGAGGAGAACCGGAAGAAGTTCGACACGGACTTCGTGGCCTTCCTCACGACGCTGTTCGAGGAGGGCCGCGGCGTGGCCGGCACGGAGCAGGAGGTGC
AGGAGTCCGTGGCCAAGTTCTTCCCGGACTGGAACCCGAGCCTGTACGAGTCCTTCATTGCGTAAGCGACGAGCGGCAGGCAGTTCACGTAGCAGTAGGA
TATCTGTGTGCGCCGCCAGTATAATACAAGATGCGATGCAAAGTTTATCTTCTGAATGAGTTTTGGTGCTGTCAAGGAGGCTTGAGTCGTTCGTCGCACC
AGTGAAGTGTCAAAATTGCTTTGCGCTGCTGAAATAGTTCTTTCCAGGATAAAAGTTAAAGTAAACAGCTTTTCACCCTTAAGCGAACTCCAACGGCTCC
TAGCAGGATTAATGCGAGAACTATCCTGAAGTCAAGTGTTTTCGTTTGTTTTTAGACACGAGAGCGCAAAGCTCTGCGTATTCAGCTACGTCGTTCTTAT
GCTTCATGCTAACCGAAAGAGGCTTTGCTCGTAACTGTGCGATCGTCACTGTTGAGCCAAACCTAGCTGCCACTCAAGAATAGTGATACACCAGGTATTT
TGCTGCCAGCCTGCCTACTTCACATTCGGTTATCGGTTCACTTCGGCAGACAGGTATAGATTGTCGACGTAGGTGCACCGTGGTCTACGCCCAAATGAAG
CGAGAAAGCAGCGGCACCATTGAAATGAACAAGCCTACGCTCGACAAACAGCCTTCGCAAGAAAACACACGAAGACGGAGCAGTCTAGCTGACGTGGCCA
ACTACCTGCACCAACATGAGTTCCACGACTACGAGATCTCGTCCAGAACCTGCGTGGCTATCTTCCTGCTCGTCTTCGTGGGAGTGAGTTTCATCCCATT
CAAAGAGTATTACCTGGGAAGCTACGTCACCAAGCCGTTCGATGAAGTCCGAGACGAGAAGGCAGCTCGAAAGCTCAACCAAATGGGGGTCGTTGTCAGC
GGTGTCCACTACTTCGACACGTTTGAGCGGTCGCTGCTCCCTCTCATCGATTTGGACACCAAGACGGATCTTACACGGTCCACAGCACTTAATCTCTCGC
TGACCGACTTCCTCGTACGAGCAAACATCCGTAGAGACGACCTCCTCGCCGGCCTACCGGAAGAAATGTTGGGGCAGCCGGTAGATCTCATGGTAGACGT
GTTGGCGCCGTTGTGCGGACCTGTGACGGACTCGACCTCATCTTGGATAGCGCAGCCCCAACTTTTGTTCGGCAATTGGTTCCCCGAGATCCGCCACGAG
TTTTGTCGCGACTTCCACGACAAGTTTGGGCTCGATCGGTTCTTCAATCGTGGCAGCAAAGCGCCGACCGATAAGAATTTAACTCACGTGGGCGAAGTTA
CACTCGGTCTCATCGCAGTTGTGAACATGTCGGAGGTGTACTTGCGCCACTTCAACGACGCTCTGGTGGTTCGCAAAATCATGAGAAACGTGCAAGAGGG
CTACATGGACTTAGACTTGGCTGAATACACGGATGCTGTTGCAGAAGCGATTGTGGATCGGTACAGCAAAGGCATCTCGCTAGCCGACGTTATCTCCTTA
CTACCGGGTTCCTTCGATGCAGCTCATGTGGCGCTGGTCGACGTGCTGGGGGTCAAAGCGCTTCTCGCCCACTATCTTGAAACGCAGCAGCTGACAATGG
GGGTAAATGTGAACGGAGAGGCTGCGATTTTGGCTGAGGTGACCCATGTCACCGCTTCCTTCTTCACCTCCGACTTCTTAATCAACACAGTGGGGATGCA
CTTGGTGTCGACGATGCACTTAGCTCCATTCTGGAACTGCGCGATCAAGCACACGTCCATGGCCAAGACGATCTCTCTCGCAGATGTCGATGGCGCTGCG
ATCAAACAGTGCGGACGTGACTTGTCGACCATCATCCCCACGTTCGCCGTGAACTTGATGTTCCTGTTTCAGAAAGACGAGCGTGATTATACGAAGCTCG
ATAACACGACAGCCTACACGCTCGGGCGCCGTCGTGAGACTACTGCTGGCTACGTGGCTCTGGACATCCCAGAAACCCTCTCGGACGCC