Description :
From Genome Similarity Track
Location :
contig_93:62980- 63989
Transcript NameFunction/comments
g13209.t1KUF96767.1 cGMP-dependent protein kinase [Phytophthora nicotianae

Sequence
1009 bases(100 bases per row)
GGCTACCTGGGTCCTGGCTTGGGTTTTGGCGAACTGGCATTGCTGTACAACATGCCACGCGCTGCCACAATCCGTGCAGTGACTGAAGTCGAGCTCTGGG
CTCTGGAGCGTAACACTTTCAGGGAGATCCTAGCTTCGCACAAGCTTAATCGTCTTCACCGGACACTTGAGGTTTTGGAGAAGGTTGCGATACTCAGCAA
ACTTACCTCATCCGAAAAGCAGCAGGTTGCAGCAGCAATGGACTGGGAGGAGTTTGAAGGGAAAGCTGCAATTGTGCGGCAGGGAGAGGTTGGTGAGAAG
TTTTACATCATCACCAAGGGCGAGATTGTCGTCACTCAACTGGACGCCAACACGAGCGAGGAAAACATTATCCGAAGACTGAAGGCTGGCGATCATTTTG
GTGAGATGGCTCTTTTTAAGGATGAGATGAGGTCTGCAACCTGCACGGCAGTCACAAGAGTGCAGTGTGTCACTCTTGAACGTGAGCACTTCATTGCAAT
GCTCGGCACACTCCAGGAGCTTATGGACCGAGAACCAGCCCAACTAGAGGCGAAACACCTCGCGCACCGGCGAGCATCAGCCGAGGAACTAGTGGACCCC
GCGGACTACAAGTACTACATGGAAATCCCTCGCGAAGAGCTTGAAGTTCTTCAGACATTGGGCCGCGGTGCTTTTGGGCGTGTCCGCCTAGTGCGTCATG
CTGCTTCAAACCGCGCATACGCACTAAAATGCCTGATCAAGTCGCATATTGTGGAGAACAACCTGAAGGAGCACGTGTTGAACGAAAACGAGTTATGCTT
GCTCTAGACCACCCGTTCATTCTCAAGCTTTACACAACCTTCAAAGATCGAACGCACTTATACTTCCTGGTAGAGCTTGCACTGGGAGGCGAGCTGTTCA
CGTATTTGCGTCGAAGAGACCATTTCGAGGAACCCATTGCACGATTCTACATTGCCAGTGTCGTGCTAGTTTTCCAGCACATGCACTCAAAGAGCATTGT
GTATCGTGA