Description :
From Genome Similarity Track
Location :
Scaffold_1460:6298- 8347
Sequence
2049 bases(100 bases per row)
AACAGGCGATGGGGCAGCAGTCGGGATCCAGGTGAAATGGAAGGTGAATCACGAGTAGATCACGGAGGCTCTACAATCTCTGACATCTCTGACATGGAAG
GACATCCATAGTATAGCAGGCACCACGGCTTATCATGCACAAAACCTGCTAAAGCTAAAAACTAACAGATTGAGGCTATGGGCAGGGGATCGACTAGGAT
ACTCGTGTGCAGCCACCATGTGCGGAAGGAGTAAACCTGTGAGGGAGCACACCTAATGTGGTTATGTCCGAATGCACAGCAAATCTGGGCAGGGTTACTG
AGGATTTGGAGTTTGGGGAAGGGCAAGATAGACGGCGACATAACAGCCTCGTCAGAAGAGCTCAGCAGCATGTTTGGCCTAAAGCTGGCTCAGCTACCCC
AATGTATCGTGAGGTGGGGCGACCAGAGATGATGGAGCCATGGGACTGTCCTTTCGAGGTGGCGAAGACGATGTGTGTAATAGGATGTGTCGTAATCACA
ACAGTCATCTGGCGCTGGAACGTCGACAAAGTGCACCCAGACGGAAGGAATGGACGCACGCTGGCTGAGGCGACAGATGGCATCAAGAAAATGGTAAGAG
AAGTGTATCGGCGCTACAGAATGGGACTCTTCCCAGTGATACCAGTACCGAAGCGTAAATTGGAGGTAGCTGAGTTCATACTCActcggtggagcagcgc
cacggaaGTCAGCAAAGAACTACGAGATCATCGAAAATGCGGGTTGGATTCATTGATTGCGGTTCTAGAGGGAACACCGGAGCAGGGGGTAGCGGCAGCG
TTGTCATGGAATTGGAGACGAAAGGAAAGCGAAAAACGCCACTGCAACGGCGCTCGGGCGATAGAACACGACGAACAACGTAGCGGGGTCTGTTGGGTTG
CAGCGGTTGTTGGCTAGAGCGGTGGAGAAGATGTGGGCAGGCCTGCATGTAGTGGGCGACAGTCAGATGATATTGAGAATGATGAAGGACAGGAGGTCAC
CAAAGGCCAATAATCTGCAGTACTCGTATCGTGAAACGAGGAGATTAGCAGATCTGTATCAAGTTTCCAGTTGGACTCATCACTAcagacgctgctgacc
gGCTAGCATATTCTGCGATGGACAAAAGAGGAagcttggtggcggcggagtCGGAGAGTCGGGGAGGAGCCTCGAAAGAGATGTGGGAGGGCTTTGAGAA
GCTCATAATGGCCGACATGGAGCAATGGGAAGCAACGGAGGACGAAAGCAGCAAAGGAGAACAGCACAGAGGAGGAGTGAAGACTCACAGGCTGTCGGTG
TGTGCAGGAAAGGTTGCATGCAGCGGCAGTAGATGGCAGTGGCTAGGTAGGAGACGAAGCACCTACCCGGAATGGTTTTTCGAGTTCACGCCCCAATTGG
GACTAATAACACAATACACCTCAATCACTCTAAAACAATGTCTCCACATCCATTCTAATAACAATTTGTATGAAATCGAGCTTCAAAAAAGCATTCGGCT
GTACTCACTCATACCagctgacattttcatattTCATATTAATGAAATAACGGGTTCTTCCGATTAGTGTACCGGTATTATAGCATTAGTATACCGCTTC
CCACTACGTTCAAAACGGAAGGTGTTGTATTAGGAGGGTACTACAGTTTTCAATGCTTCTTCCTCCGCACCCATGCAACTGAGCCATTCCACACAAAATG
CAAAATGGTATACTATTTGGAGGGTATTTTAACTAGTATTGCAGTCTGACGCTAGGTATTGTATTCGGAAGGGTATTCAATTGCGAGGGGGTACTTAAAT
CGGAAGAATACGTTATTTTTAATAATTTTGCTCTTATCGTCCGATTTAGGAAATGTATACCACACCAACCTCCCTATGACGATAACTTGCTATACTTGAT
ATTGTGCGTTCTATTCGAAATTTCCGCAGCCGATAGATTGAATCTACCAAGGGTATAGTATTTTTAAATGTCTacactaagtacgaatctAGCATTGGCA
TGTACGAACAGCTGTTTTGGCGCTTGGGCGATTCCACTAAAGACTGTAA