Description :
From Genome Similarity Track
Location :
Scaffold_57:62973- 66335
Sequence
3362 bases(100 bases per row)
TAGCATGGTCGATGGTATATTCTATGACGCTTATCAGTTAATTGTTGCAAGATCTGGACAACGCAATGTGGTATTGTTCGTTGGACACGGTTAGTGAATA
TTGGGTGGTGGAGATGACCGAACGAGCAAGGATATTATTTGCCTTTATCACACCATCGGTTCTTTTTAAATGTTTGGTAATGTCTTTTGAGCTAAAGAAG
GCTATATAGATATATCAGGGTTTGATTGATAACGCTTTGTATATATATATATCACGATCGACGCGGGGAAAGATGTGATCCCCACAGATTCCCCTCAGTT
GACAGTTGTGTTCACTGAAGGAAAACCCGAAACCGACAGGACGCCGTCAGTGCTGGACAGGAGATATTATATTGATGATCTTTTGATCCCAGCGACATCT
TGTATTTCTCCGTATAACGAGTAAGGAGATCACTTACGGTACGCGCTCGATGAAAATTGTCAATCAGTTTGACTACGATTTTCACGGCGTAAATTAGATT
TTTTGGGTCGCCAGGTAATTCTTGCCGGCGCCGTAGATAATCCTAAGGATTAGAATCGCTGGTGAATATCCCCTCCCCCACGATGTTGCGCTCCATTCAG
CCGTTCCTGGGTAGTTTAAATTACTACAGCCGCTTTATTGAGGTATTTTCAATAGATGCATCTGTGTTATTCGAGCTACGAGAGGCAGATTTTTTCAAGA
TTAATCGTATGGATGGTCGTGATACGATGGTAGGAGATCGCTATCACTCTCCTTTTGAGGTGGGGAATCACGATCTCACCCTCCGAGGAGGTGATCGCGA
TCTGAATGGAAAGACCCGGTAGGAAGAAGCTACAATCGCTTTCAATAGGTTAAAAGCCAAGATAGTTACTACACCGATCCTCAAGCACTTTGACGCGGAC
CGACTTCCAGTAATTGTGGTATACGATAAAAAGAGGGAAGTGTCGGCATCCCTGTTGCAGGAATATGATGGTGTATACTGACCGGTGATGCACGAGCCGT
ACACTGAAGTTCAATGGAATTAATTAGGGCATGGTGGGGAAAGAGGTGTTACCATTGCTTCGAATTTTGGATGTGTGCTATACTATGCTGGTATCCCGGG
AGATTAGGGTGCTCACTCGATTTTCGACACTAGCTTGGCTAGTCCAATCCTCCGGCCTCAACGGTAGGCTAGGAAAATTGGCCGCGTTGCTATCGAATTG
GATGTTGGAAGTCCGGAGGTGTGAGAAACGGGAGGACGAAATAATTGACACCCTCGTAGCCAGCATAACTCTTCGAAACGAGGTAGATGAGATGTTGATT
GCTACCGCTAAGAAGAAACAGCCTAGACATATTGTGACCATGCCACCACCAACGGTGGAAACGGATGAGAGTCTGTTGGTGGTTAGATTCGATGGATCGG
CCCGAAATAAACGGAAGAGTGGGTCGTATAGTGCTATCGTGTTGAAAGCTTCCAAAATCGATGATTATCGCGGCGGCTTCGGAATATGCAGTAGACCTAA
CGGTGAATACGACTGAATAGTGCGGCTTCTTACTGGGTTTTGATTTGCTGGCTGGTCGACTAGGGGAAGTGTTATTATATGTGGCGAATTGAACCCAGTA
ATCTGGCAGATGCGGGGTGAGATGGACTGCAAAGCGCCTGAGTTACACCTGTTGCGTCACAAAGCGAAGCGAAGGCTTAGATCGTGGCCGAAGCACGACT
TCTTACATATGAAGCGGAAATAGAACCAAAGCGCAGATCAAATAGCTAGTGCAGCCTTGCAGCAGGAGAATGGTACAATCGTAACTTCAGACCAAGATCT
AGAAGATTTGACATCATTGAACCAGCTGGGCAAATTGATTATGCCAAAAATGTTGGATCAAGTGGTGAAGATGGCTGCAATAACTCGATCCACGCGGCGA
AGAACTCGGCAACCCGAAGTTTTACAAGAAGAAATATTACAGCAGATTCGGATCGAGCGGATAAAGCAGGCACAAGAAGAGAACAACTGGATCGCCAACC
TGAAAGAATACCTGATAGGCGATGTAACCCTGCTGAGTGCCGAAGAATCAAAGAATGTGCTCGGATTGCTCCGGATAACGAACTAGATGAAAATGGACTG
CTGTTTTTTAGCTTATGATCCTTTAAAAAGTCGGATGATCGTATGGAAATTGTCCCTCTGGTTGTACCTGAATTGGTACAACAGGAATTTATGAATCACT
ATCATACGATTTTGGAAGGTGGTCATCAAGGGATCAGGAGGCTATATCAGCGAATTAGGTTCAATTACCATTGGAGAGGTCTATATTAGAGCATCCAACG
TTATAGAAGCGAATGTGTGGACTGCACGACTGGGAGAAGGCTACCTGTAGTTCATGAGGGCTCATACCCATTTCAGGTGATCGTACTGGATCACATCCCG
TCCCTCCCACGGTCAAAAATACTTAGCTACTGCTGTATATTCTCTCGGGTAATGTGATCGCGAGAGCAAGCTCGTCGATGACCGTGCAGACAATCGCAGA
AGGTTATGATGAATCTGTATCTCGAAGATTCGGAAAAAGCGAAACGATCCGTCACGACCGGGGGTCAGGATTTTTGTTAGATATTTCTCGAGCGTTTAAC
CGAACCACAGGGCAAAAGCAACGCGCGTCTATGGCTTGCCGACCTCAAGCGGATGGAACAGCAGAACGCATGGTGCAGACGTTAATGCAGGCGATTGAGA
TGTTGTCGCAGATGTGGATCAAAAGGATTGGGCCAAGTACGCGTAAAGGTTGGCGTTCACCACTAATACGACATGAAATCGCGTCCGCGGAGACATACCA
TTACTTGATATAAGGTTGGAATCCAAGGTCGACGCTGGAGTCAAATCTTCCGTTAAGAAGTACTAAAACACGAGATGTTGACCCTCGACATTGGTGATAT
AACATCCAGCGCCAATACCAACGAGCAAGAGCAGCGTTGAACGGACGTGTCAAGATCGCGATACGAGATCGAGCTGATCAGCATAATGCTGATCGTTATT
CTTTCAATATAAAGCGGGGAATGCAAGTCGGTATCTATCTGGATTGGGTCAGAGACAGATAAGTTGGCACATATGTGGCATAGATTGTTTCAAGTGGCCG
AACTGTCTGGAAAATATACAGTGCGGTTGGAGATAGCAGGAACACCATACCGACTGTTTCCAATATTGCACGTTTATAAGTTTAAATAAGTGGTAAAAAA
TTCCTTGATCGTCCAGACAATGCGTTAGTGGTCAAAGATTGTGATCGCGTAGATTTCGATGAGTCGCTTCTGCCGGAAGACAGCTGGGAAAAAGAATTGG
CTGCCAACGAATATGAAGTGGAGAAAATCTTAGACGTGCATTCGGGACGTAAAACCCGTTAT