Description :
From Genome Similarity Track
Location :
Scaffold_121:6297- 11062
Transcript NameFunction/comments
Phypl_g3589hypothetical protein

Sequence
4765 bases(100 bases per row)
CGCCCTCGTCGGCAAGCTTAAAGAGATGGTGTTTGTCCTGCAGACGATGATgcacttgcagcagctcgctctccgGCCCCGCGAATATGAGCTCCAGGTA
GTTCATAAGTAGAGCTAGGCAGACTTCTTTGAACTGCGGTGCTATTTGGCTGTTTTGTTGTATATCCAGGTCAGTTGGTTTCCACACCACCATGGCATGG
CCTTCACAACTAATTCCCATCAGACCCTCCACCTTCATGTGTCTCGCGCCTGTCACCACTTTCTGGTATTTACTCCACGTTCTTTCCTTTCCGGCGCTGT
CCCATAGCCTCATCTTCGTTAGCGACAAGCTGACAACGGGCTTGCAGCTCATGAGATCTCTCGCTTTGTATCTGTTAGCTCTCTGTAGGTTCATTTCTTC
TCACAACGCCCCTGAACACGTAATTATTAGACCATTGCGTGCACCAAAAGCTCCGCCGTTCCGTCGCCTCCTTTCTGCAAAATGTCCCCCACGGGTTGTG
CTTGGTCCTCTGTGGTCATAGCCATTTCCCGATCATGTAAGCAGTCACTGCCACTAGCTCCGCTCGCAGGTTAGGCAATCCAATGCCACCTTGGTGGGGC
GGTAGCTCTGCTATAGCCCGCTTGAACCAGACTTTAGGCGCCCGAGGTGGCTCTGTGAAGACCAAATTTCACACGTAGTTTCGTATGGACGTATCCACCG
TCTTAAGCAGCGCCTCCGTTGGTCACACGTGCCGTGTCACGTATAGGAGGCTCGGTACAATCACTGCCGCCGCTAACGCAGCTCGTTGCTGTGCAGTCTT
GGTCTTCGATTCCGCTAGCGCCAGTCTGATGCGTAGTGCCCCTAATACTTTGTCCCAAGGCTCCTAAGTCCTGTCACCGCTTCCCGCCCAGGACGAAATA
CCGTGCACTGGGTGTTCCGGCGACCTCTTGTGGGTAGTTCACGGGGTCTCGGTCTGCAGTAATTCGGCTGTGTTGTCTGCTCGCTCTACCTCCTCTGTCG
TCAgggtttcttcttcttgcacCTTGTCGATTGTTGTTGCTCCCAATCCAATCACTGCCCACTTTTGAACGTTTGAACGTAGACAGGATGCCGCTGCAAA
TCTTCTGACTGCCTGATCGCAGCTGCCTGCATCGCTGTGTCCACTAATTAAATGGCCATGTCGTTCGCATAACCTGCCACTTGGAGTTGAATGGAGGCTT
GGGTGTCGTTGAGCGGAATACCGGCTGTCTCGTCATCATGTATTCATCGTACAAGGGTTCAATGGCGATAATGAAAAGAAGGGGCGCCAGCGGACACCCT
TGCCTAATTCCGCCGGTGGTCTTCACTGCCCTTGACAGATCTTCATTCACCATGGACCTCACTGTCGTGCTCAGCACTTGAGCTGCAGTTAACTCTTTTT
CCCTTGCAATGCTCTTTCGCTGCCTCGAAAAGGTCCATGGCCTCATGCATGGTTTTCCCAGGTACGAAACCAAAATTGCGTATTGTGCACTACCGTAGTC
AGACACTTACTTAGTCGTCATGTTAATAGATGTTGTAGTCCGTGTAAAACAAAACAATTGGCCTGGCGTTCAACGGTCTGGTGTTGCCTCCTTTAGAGAT
GAATGATTCTCCAAAGGTTTGTCCGAATCCTTCCCTCCTCCATGCAGGCATTGAGTAGCCTCGTGAGCACCGGTACCAGTATCTCGACCTGATCCAGATA
CCAGTGATTACTTAGGTCATCAGGACTGCAGACTTTGGCTCGCTTGTACTTCTTAATCGCTAGTAGTACCTCTGTCTCGGTTATCTCGACGTCAATGTCC
TGCATATACTCCACTTGGCAGGTATCCTGCATTCGTGTGGCGTATTCTTCAACGCTTTCCTTTGCCTCTGCTGTACCATTGAAAATCTCTTGTCCCGTGT
CCGCAAGGATATTAGCCTTGTTGTGTTGCGTTTTTTCCTGTCGACCATGGTTCGGCACTAGAGTTGGTATAACATTATCTCCGTATTTAGTACATATTCG
TCTTGAAAAATTGTCTTGTACTCTTCTTCGATCTCCACACATCCCATGCCACCAGTACTCTCCTTCTCCCCGCTCGTCTTGTTTCCATGAGGGAGTGTAG
TTGGATGAGTAGCGCTGTCCTCTCTCTATCGTCGTACCGCTCTGCAAAACCGTGCTAGCGTAGCTTAGTTTTTGCCTCTTGATTTTTTGTATTTATCCGT
TGTTGGTCCCTCGCGTCTGCTTTCAAGTTCGACATGTCTGTCTTAGTCTGCCCCTTGAAGGCATCCCAGCTGGTTATTATCCGCCTCTTTCATTGCGCAG
CCGTATTTGGTGATACTCTGGCGAATGAGGCTGTCTGTAGCCGCCTTGACGAAGGCTGGAGGCGGGTATACTTGTCGCCGTTTCTTGACACGTATTTCCC
CCTTAGAGAGTGTAGCTCCAGTAAAACCGCGGGGTGATCCGCCTCACAGGGTGAGCAGCCCCGCGCGGTGATCAGCTCCACACGGTGATTCCTCTGTAGT
TGATCCTCTGATTAGCCTCCGCGCCGTTGCCCCCATGTACCATCTATCCAGCCATGAAGTCCCAATGGCCCTGCTAGCTGCCGTGTACCGGTGGGTATGA
TGCGTGTCCGCATTGGCCTGAACCTCCTTGTTTCCCTTCGAATACGACACGGTAAGTATTCAGCATCAACGAGCCCTGCCTGCACAACAAATTTGCAAAG
GTCTTTTGCTCCTATATCCTCACGCTGTGTACCTCCAATTATGTCCTCTGGTTCGAGTACGCAGTTAGAATAGCAGCCACATATGACGCTAGAGAGTTTT
CGCTGTCGGAATTCCTTGTCCTGTTCCAGAAACTtaagctggacgagaacagggaggaggaagacaaATCCATCTGTTTCGCGGACAATCCTCATCCAGT
CCGGCTGTAAGGTAGTAGGATAAGTTGTTCGAGTTGCCGTACGTCAATCAGCCTCAGCTCTCGACCCGACCACCAGTCGCTTATATTCTCCATCCTGTCC
CCGCTGCAACTATGCCTCCCAAGCAAGCTAAAGCTGCCAAGACCCGCAGAGAAGGGCCTCCCCACGCGCCACCAAGCCTTGCCCCTGGGGCGTCGGAACc
gcagctggaagaagaagaagatgctgctgctgcttatGTTTGTGATGTGAAACGGAAGCATAAAAGTTTAGCAAGGAGGACgatctcgtcctgctgcatC
AGGCTCAAGCTGACCGTCCATTTGCAGCGGATAGAGGGTCGATAATGGACGCATGGGCTGGAACCGCAGATAAGGTGAAGCGAATTGAAGGTTTTGGTAA
TGCCAACCTCACCAACAAGTCGGCGCAAGCTTGCTTCAACGTTCTGCAGGAACCTCTCGGGGTGTTCAATGCTAGATCCGAGAGGGCATTGGGTGTATCG
GAGGACTGCACGGAAAAGCATCAGCTGTTAGACGATCTGCTGTCTACAGTTGAAGAGCATGATCGTAGCGAAGCCCGTCGTATCCGCAacgccaaggcca
agatcaGAGCGGAAGAAGATGTAGGAAAGATGATGGGCGACGTCACGATGGCTCGCATGAATGATCGCAAGAGTGAAGATGTATCCCCTGAAGACCTTGC
CAAGCGCAGTAGACTGAATGGTGGCACCGTCATCGACCTCATTCGGGAGGACTCTGAGAAGGAACACCAAGCAAAACAGCATCGCTGGAAAGAAAAACAG
AAAGGGCACACGTGCGACcgcgagatgaaggagcgcCAGTGGAATGAAGAGCGCAAAGAACGCGATGCAGAACGCAGTTTTAGACTTTAGCTCGCACGTT
TGGACACCGAGCGGCTGGATAAGATGCTTAAACTGGCTACGATGGAGGCGACCAGGTCGTATGACAGAGCCGACATGTCTTAACTAAGATAAGCTCTCAT
CGAAGGAGGTAACAGGCCGACGAAGGAGCTGATTTGGTTCGGACTGTAGCAGTTGTGGCAATTCGTAAGTAGCATTGCTACCTTGACAAAATTACCGACA
TGTGACAAGCGAGCTTTCTGCTGTTTCTTGAAATCGATGTATGGCCAGAgtgtcttcatcatcttGAAATTCCACTCAACGGACTCTCTTACACTGCTCA
TCTCGCGATTACATACCTGCTCAGTTGGATCACTCACGTTACCTTTGTAGCCGCTCACTATGTATTGCTGTACCCCATTGCCGGGTCTCCGTATACTGCG
CACCCAGCAAAAATGTCTCGGTGTTCAGCAAAGTATTCCAGCAGCTTAGCCCTTCCATCGGACCCCAAAAGGTATACATATACCATCCGGAGCCGTAACG
GCTTGATAGTTGAAGCAATGATGACGTTTGTGACCACTGAAAacctggcgctgcagatttTTACCACGCACACCTCGGCGAGGTGCCGGTCTCGCAACAC
AAACTTTGGTTCTGTCAAGAAAATCAAAAatgttgtccagcagcgcaccTTTATCCTTCATTGCATCACAATAGCCTTGCATTCTATCAGACAAGAGAGA
TTGCATTGCGGAAATGGTGTCTGCGAACGTGTTGTGAACGATATCGATCATGTGAAGAAATATTCTCGACATCGCTGGCGCAGATCGACCAAAGGTTTTT
ATCATGTCAAAATATCGCTTTGGGAAGGCAAGTTGCGCCAGCATGATACAAAGAGCTTCGATGCCTGGCAGAGAGTCTCGGTAATCGGTAACGACGACAT
TGGGAATCCGAAGAAGCACCAAAGCTCATGAACTGCTGCCACATTGAAACGAAACTCCAACTCTG