Description :
From Genome Similarity Track
Location :
contig_104:62955- 64128
Transcript NameFunction/comments
g11073.t1hypothetical protein

Sequence
1173 bases(100 bases per row)
TTACTGCGCTACAAAACTGGACTGGAGAGCGACACGAATCCTGCTCGAAGACCGATGCAGCTACGCTTTGTGTGTTGTGAGCTTTCCCCGGAAGAGTGGG
CAGCGCTGAAGCAGTTGGCACGACTTCTGGATCCTATTGAGGGATTAGTGCACGTCTCGCCGCTCGCTTATCCTGGCCTGTCGATCGTGTATCCGCTCTT
GCACTCTTTGAAAAAGCATTTAGCGGATGCGGGGGCGTGGGTGACTGATCCGCTTGTCGCGACAGTTCGTCATACTATCGTCGGCAACCTTAACATGGAC
CTCTGCTCATCAGGACAAGCTCCATCGTCGCCGTATTTATCGTGTCTACTAGACCCACGCTTCAAGTCACTGCCGTTTTTGCCAGCACCAGAGAAGGAAC
GACTCATCGAGGCACTTTACTTGCTTCTCGGCGTGAATGACAAGGACGATGAAGGCGTCGATGATGGTCAGCACCAGCACGACTCATCTACTGAAGACGA
TCAAAGCGACGAGCAGAAAAACAAGACGGAACGCCAAAGGTTCGACTGCATCGGCAACAAGCGCCTCTCTTGCCAACAAGAAGGCAGCAGCTCTGTTGCA
CGAGTTCTTCCCGCTCGACGAGCCTGCCACCGAGCTCGACAAGTTAAAGGCTCAGGTGCAGCAATTTCTGGACTCGCCGTCTCTGCCGGCTACAGATGAG
ACCGAGCACGACCCGCTGGAGTGGTGGAGTCGCTATCAGCGACTTTTCCCGTCGCTAGCGCGACTCGCCAAGAAGTATCTGTGCATTAGTGCCGTGTCAA
CGCCGTTCCAAGAAGCGTTTACAAACTATGGCCAACTGATGCGAGAGAAGAAGGCTCGACTGGACATTGAAGTGGCAGCTCAGGTGCTTTTCTGTCGAAG
TGTTTCTCGGATCCCAGAGATGGAGCGCATCGGAGTTTGAGAACGGAGGACGATGAAGAAGATGTTGTCGAAGGTGATTATCGTGTTTATTCGTGTGGCC
TTTCAAATTATTCGCTTTACTCCCATGGATCAGCTTGTTCGAGGTTTGGCATGAGGTTAGCGTCGTTCATTGGCGCCTCGTTGGCGTTGAAGTCCACAGT
TTCCAGCCCCGAGCGTACGCCGTCCGTCAGATCGTCCCACATGACTAATTGATGTTCTTCAGGTAGTGGCTAG