Description :
From Genome Similarity Track
Location :
Scaffold_50:62938- 64472
Sequence
1534 bases(100 bases per row)
AACCCGCTCCTCGAGGCGTTCGGCAATGCCAAGACGATCCGCAATGACAACAGTAGTCGTTTCGGCAAGTTCATCAAAATCTACTACCACGACGATGGCA
CCATTTCCGGCGCGACGACGAGTCACTTCCTGCTCGAGAAGAGCCGCATCGTCGGGTCTGCCGAGTCGGAGCGCAACTACCACATTTTTTACCAGATCTG
TGCGGGCATGGCTGCGGCCGACAAGGCTGCACTGAAGCTCAAGGGAGCCAATGACTACTACTATCTGAACCAAGGCAACTGCATCCAGGTGCCCGAAATC
AATGACAAGAAAGATTTCAAGGAGCTCGTCGACGCCATGGGGACCGTCGGTATTGACGCCGATCTTCAGAAGACCATCTTTCAACTGGTGGCGAGCGTAC
TGCACCTCGGCAACCTCGAGTTCACGGAGAACGCCAAAAATGAGTCGCAAATCACCAGCCCGGAAGATGTGGCCAACCTGGCTGAGCTCATGATGGTCAC
CCCAGCCGAACTCGAGTTTGCCCTCACGAAGCGAACCATGTCAGCCGGAGCTCGAGGGTCGGTTGCTGAGATCTCGTTGTCGTCGGTCGAGTCGTTCAAG
TCCCGTAATGGTCTTGCCAAGGACATTTTCAGCAAGATCTTTGACTGGCTTGTCTCGCAGATCAACAAGTCGACCCAGCAGATCACAGGCAACGGAGGGA
TGGGCACAGCAGCCAAGTTTATTGGTATTCTGGACATTTTCGGGTTCGAGAGTCTTCAAGTCAACTCGTTCGAGCAGCTCTGCATCAACTACACGAACGA
AATGTTGCAGCAGCAGTTCAACCAGCACGTGTTCGTGTACGAACAGGAAGTGTACGTCGAGGAGGGCATCGACTTTTCTCGTCTCGAGTTCAAGGACAAT
GGACCGTGTCTCGACTTGATTGACAAGAAGCCGCTCGGTATTCTCCCGCTCCTCGACGAGCAGGCCATGCTCGGTCGGCGCGCCAGTGACGAGAACTTCA
TCCAGAAGCTCCACCAGACCCATGTCAAGCAAGGAAAGGTACCCGAGGGCACGACAGTTTACTACTCGAAGCCGCGTTTCGCCAACGATCAGTTCACGAT
CCACCATTACGCCGGCGAAGTCACGTATCTGGTCACGGGCTTTTTGGAGAAGAACGACGATTCGCTGCATAACGACCTGATCTCCCTCATGGACAGCTCC
AAGTGCGACTTCCTGCGCAAGCTGTACCCGCTTGGCCAAGGTGCGAAGCCCGGTCCAGGTGGCGGCGGTGCTGGTGGCAATCCTGCACGGAAACCGTTGG
CTCGCGCAGGAAACAAGATGACAGGAACGATGACAGTGGGACGCAAGTTCCGCGACCAGATGGCCAATTTGATGCTCGAGTTGAAGGCAACGGCGCCGTG
GTTTGTGCGGTGCGTTAAGCCGAACAATCTCCGCTTTCCGCAGGGCTGGAATGCCGAGCTGATTTTGAACCAGCTGATCTACCTCGGTGTGATGGAAACC
GTGCGGATCCGTCGTTCCGGGTTCCCTGTTCGTC