Description :
From Genome Similarity Track
Location :
Scaffold_348:6293- 7882
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_348-fgenesh-gene-0.3CBL-interacting serine/threonine-protein kinase
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_348-abinit-gene-0.34Syntaxin

Sequence
1589 bases(100 bases per row)
CATTTCCGACGAGGCCATGATGATTTAAGAAAAGCAGCAGCATGACGCCTCGTACCGATTTTGATCAGTAATTAAGTAAGTAGCAGTGTTAGATGATGAT
GCATAAAGGCAAACTCAGAGAAAAAAAGTGCCGCCAAGGCTTGTATATATACTTTATTCCCTTCCGTCATTGCTGGGACTTCATGCTTGCATATTCCACT
GGCCAAGCGTTTACTAGTGGTAGTGACTGCGTTGTGATATCATCAGCGGACAATGCGTAAGGACGAAAGACCAAACGCTCCGTCCTGTTGGTCCCGTTGA
GGGAAAAGCTCGGTACGCATGACGTCGTTCAGCGCCTCGAGCGCTTTACGAGCGTGGAAGACGACCACGGAATCCTTGTCCGTGCGCTCGACGACCTTGA
GCATGTGATACATCGGCTTGAGCTGGTCCGGCATGACCTCGAGCATCTTCCAGCCCATGAGTTGCACAAGGTACTTGAGCAAGAACGTCGCGCCTCGGCG
CACGGCAACGACGCTTTCCGTNNNNNNNNNNCCAACTCAAGTTGCAAAATCCCAAACACACACGTCATCACATCCACTAAGAACGGCTGTAGACTCCATT
GAAGCAGCACGCAGACTTCGGCTAGATTCGACAGGCAACTCGCGCGAAGCGTGGCTTCCACGAGNNNNNNNNNNGGTGCTATTGCCACCTGCATCAGCCT
CGACTGCTGTTTCTTCATGTTCTTTATCTTCGCTGCTGTCGATCTCTTGGATAAGCTGGAAGCGTTTTGGCGGCGTGCGACGAGTGCTTTGGCCACGCGG
TGGACGAATGCAGTCCAGGTACGCGTACACAAACACTTTCGCATACTTTGGCAGCGTTTCGCCGCACCGCTTTGCCGTGAACAAGAGTGCTTCGCTGAGC
TTGATGCGCTTCTCAACAGAATTGTCGCGGTTCCGAAGTGCATCCACGAGAAGCGGGATCGTGACGTCCGGATGCGCGTCTGATAGAGTGGACAACCCTT
GCACGGCGGCCAGAAACACATAGCTTTCGCCGTCTTCCAAATGGGTCAAGAAAATCTGGATCAATTGCTGGATCCGCGGTGTCCATTCTGGGTCGTGACG
TACTTGCTGACTTTTCCGCACGAGTTTCGTCAATGAGACCACGCCTCGTGCACGCAGTGGCACCAAGTTGCTCCGGAGATCGTCTTGCGCCTCTTGCAGG
ACTTGAGAAAACGATTTGGTGCTTTGACTTGCGTTGCGGTTGTCATCGTCTTCGTTGCCACGCGCCAGGATCTTCACGCGCGCATCACTCGCGAGCTCCG
CGATCTCGGGCCGAGTATGGTGTGAGAGAACCTCTAAAACAGGCAGCATCGCCTGCAATTGCGTTTCTTCGGCCGCACTGCGCTTTGTGGCCCCTGCTTC
CAAGATCGTCATGACGACACCTAGGCAAATCGTCAAGATTTCGTCGCTCTCACCTTCGTCGTCGTCGTCACCTTTGCCTGCAGATGCCGCGAGTCCACCA
TCAACTTCTTCAATCAAAGCATTCAACTGCATGCTATCGTCAGTCGAGTCCACGATGCTTGCTTTCGGCTCGTTGTACGTTGCCAGCAC